Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probe: antiprobe compositions for high specificity dna or rna detection

An antisense probe and probe technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of expensive targets, complicated washing steps, and time-consuming

Active Publication Date: 2014-07-23
GENETAG TECH
View PDF56 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Like FISH probes, its washing steps are equally complex and time-consuming
However, target preparation and labeling are expensive as each target sample is unique, limiting its use in routine microarray-based assays, especially in clinical diagnostics

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe: antiprobe compositions for high specificity dna or rna detection
  • Probe: antiprobe compositions for high specificity dna or rna detection
  • Probe: antiprobe compositions for high specificity dna or rna detection

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0186] Cycling conditions: Real-time PCR was performed in MX4000 instrument (Stratagene, Inc) with HotStart-IT probe. RTM Quantitative PCR Master Mix (USB, Inc.) (2x) was supplemented with 1 μl of 25 mM MgCl in a 20 tl reaction 2 . To initiate hot-start conditions, tubes were heated at 95°C for 5 min, followed by 40 cycles of two-step PCR (denaturation: 95°C, 15 s; annealing / extension: 58°C, 1 min). The templates used were ULTRAMER.RTM oligonucleotides (DNA Integration Technologies, Iowa, USA) containing EGFR gene fragments targeting EGFR gene fragments with or without T>G transversions, respectively.

example 2

[0188] Internal DDS (iDDS) probe for detection of VKORC1 SNP variants: Antisense probe composition: A significant warfarin dose-related SNP variant is located within the VKORC1 gene encoding vitamin K epoxide reductase subunit 1, At its position 1639, it includes a G>A change relative to the wild-type mutation. To detect these two SNP variants by real-time PCR, the probe, antisense probe and the following primers were used at the following final concentrations:

[0189] VK-1639G-probe: 5'-FAM-cgcacccggccaatg-Phos-3' (SEQ ID NO.: 1) at 200 nM;

[0190] VK-1639G-antisense probe: 5'-catcggccgggtgcg-BHQ1-3' (SEQ ID NO.: 2) at 400nM

[0191] VK-1639A probe: 5'-FAM-attggccaggtgcg-Phos-3' (SEQ ID NO.: 3) at 200 nM

[0192] VK-1639A-antisense probe: 5'-cgcacctggcctat-BHQ1-3' (SEQ ID NO.: 4) at 400 nM

[0193] VK-forward primer: 5'-cctctgggaagtcaagcaag-3' (SEQ ID NO.: 5) at 200 nM

[0194] VK-reverse primer: 5'-aaatgctaggattataggcgtga-3' (SEQ ID NO.: 6) at 200 nM

[0195] Whereas ...

example 3

[0213] In-house DDS (iDDS) probe for real-time PCR detection of single-base variations in the EGFR gene (exon 21L858R mutation) associated with lung cancer diagnosis and treatment: To detect EGFR exon 21 suspected to be present in nucleic acid samples In the presence of mutated codons L858R, and possibly 858L wild-type (normal) codon sequences, the following oligonucleotide probes, antisense probes and PCR primers were synthesized and used at the indicated final concentrations:

[0214] EGFR858R probe: FAM-cagattttggccgggccaaactg-phos (SEQ ID NO.: 7) at 200 nM

[0215] EGFR858R antisense probe: cagtttggcccgcccaatatctg-BHQ1 (SEQ ID NO.: 8) at 400 nM

[0216] EGFR858L probe: CalRed610-cagattttgggctgaccaaactg-phos (SEQ ID NO.9) at 200nM

[0217] EGFR858L antisense probe: cagtttggccagcccataatctg-BHQ2 (SEQ ID NO.: 10) at 400 nM

[0218] Forward primer: gaaaacaccgcagcatgtC (SEQ ID NO.: 11) at 200 nM

[0219] Reverse primer: ctgcatggtattctttctcttcc (SEQ ID NO.: 12) at 200 nM

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions and methods are provided for amplifying and or detecting nucleic acid targets using labeled polynucleotide probes and antiprobes that interact together and with complementary targets. Competitive thermodynamic interactions of these components result in signaling changes that indicate target frequency, and can provide error-checking functions that facilitate single base discrimination. These probe:antiprobe compositions enable real-time PCR detection, end-point detection and microarray detection of microbial species, drug resistant mutants, and cancer related variants. Some probe:antiprobe systems function as an internal probe, between two primers, and some function as a primer-probe. Some target sequences are discriminated or quantified by employing two probe:antiprobe systems to detect different aspects of the same template.; Systems are also provided that enhance target amplification and detection for specific single base variants. A probe may also be modified by introducing a base mismatch to increase thermodynamic discrimination of a correct versus incorrect target differing by a single base.

Description

[0001] Cross-Referenced Related Applications [0002] This application claims priority to U.S. Provisional Patent Application Serial No. 61 / 534,925, entitled "Probes: Detection of Highly Specific DNA or RNA by Antisense Probe Compositions," filed September 15, 2011, which The entire content of is incorporated herein by reference. [0003] sequence listing [0004] The present invention includes a Sequence Listing, the entire contents of which are incorporated herein by reference. technical field [0005] The present invention relates to compositions and methods for identifying and quantifying DNA or RNA sequences in the technical field and specificity of nucleic acid probes. In particular, the invention relates to labeling and detection of targeted genes during or after amplification of genes. Background technique [0006] Detection of targeted polynucleotide sequences is generally based on methods that allow labeled DNA probes to hybridize to the target sequence of inter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12M1/34C12N15/11
CPCC12Q1/6832C12Q2537/1373C12Q2537/161C12Q2537/163C12Q1/6876
Inventor 戴维·A·谢弗
Owner GENETAG TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com