Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Clam DNA (Deoxyribonucleic Acid) binding inhibitor mmID2 genes as well as encoding proteins and application thereof

A technology of inhibitory factors and encoded proteins, applied in the field of molecular biology, can solve the problems of lack of growth additive factors, failure of cells, and provision of growth environment, etc., to achieve the effects of inhibiting cell differentiation, promoting cell proliferation, and compensating for low natural protein content

Inactive Publication Date: 2014-06-11
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as far as the current situation is concerned, the tissue culture of shellfish has not yet made a breakthrough, and there has been no report on the successful establishment of shellfish cell lines.
The lack of suitable growth additives in the medium, which cannot provide cells with a growth environment similar to that in vivo, is undoubtedly one of the key factors affecting the successful establishment of shellfish cell lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clam DNA (Deoxyribonucleic Acid) binding inhibitor mmID2 genes as well as encoding proteins and application thereof
  • Clam DNA (Deoxyribonucleic Acid) binding inhibitor mmID2 genes as well as encoding proteins and application thereof
  • Clam DNA (Deoxyribonucleic Acid) binding inhibitor mmID2 genes as well as encoding proteins and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] A cloned clam DNA binding inhibitor mmID2 gene has the base sequence shown in SEQ ID NO.1.

[0017] The cDNA sequence cloning of clam DNA binding inhibitor mmID2 gene among the present invention comprises the following steps:

[0018] a) extraction of clam total RNA and purification of mRNA;

[0019] b) Clam cDNA library construction;

[0020] c) Large-scale determination of the EST sequence of the clam cDNA library;

[0021] d) Homology analysis of clam EST sequences and screening of mmID2 gene fragments;

[0022] e) The full sequence of mmID2 obtained by RACE amplification and the verification of the full sequence.

[0023] The sequence listing SEQ ID No.1 is:

[0024] CGACACGAGACAGAGTAACACAGTCAAATACTGAAAAGTTTATTTCACTTGGATTATTTACCAGTTTTGAATTCGTTATCAAAATGAAAGCTGTTACACAAGGACTTACAAGAAACACAGAGATCGGTTTGAAGGGAGATATGTTCAGGATAAACAAACCGAAGCTGGATGACGGCGAGATGGCCGCCTGCTTCCTGAAACTGAAGGAGCTCGTACCCGGTATCCCGGACGACAAGAAGATCTCAAAGACTCAGCTCCTGCAACACGTTATTGACTATATCTATGACCTGGAACTATCCC...

Embodiment 2

[0047] The base sequence of the clam DNA binding inhibitor mmID2 gene sequence table is described in SEQ ID No.1, and the amino acid sequence is described in the sequence table of SEQ ID No.2.

[0048] The sequence listing SEQ ID No.2 is:

[0049] Met Lys Ala Val Thr Gln Gly Leu Thr Arg Asn Thr Glu Ile Gly

[0050] Leu Lys Gly Asp Met Phe Arg Ile Asn Lys Pro Lys Leu Asp Asp

[0051] Gly Glu Met Ala Ala Cys Phe Leu Lys Leu Lys Glu Leu Val Pro

[0052] Gly Ile Pro Asp Asp Lys Lys Ile Ser Lys Thr Gln Leu Leu Gln

[0053] His Val Ile Asp Tyr Ile Tyr Asp Leu Glu Leu Ser Leu Asp Phe

[0054] Gln Pro Val Val Phe Asn Ser Thr Pro Arg Glu Pro Leu Met Glu

[0055] Lys Ala Ala Pro Asn His Thr Glu Asn Ile Val Ser Met Glu Glu

[0056] Ser Asp Asp Glu Ile Glu Arg Pro Val Ser Lys

[0057] Its complete encoded protein contains 116 amino acids, its predicted molecular weight is 13.16kDa, and its isoelectric point is 4.9. It has a typical basic helix-loop-helix (bHLH) pattern structure. ...

Embodiment 3

[0062] mmID2 recombinant protein inhibits the differentiation of mouse myoblast cell line (C2C12 cells) and promotes cell proliferation experiment:

[0063] 1. C2C12 cell culture and differentiation induction: C2C12 was cultured with DMED containing 10% (volume) fetal bovine serum at 37°C in 5% (volume) CO 2 C2C12 cells were inoculated into DMED medium containing 10% fetal bovine serum at a cell concentration of 2.5×104cells / ml. When the cell attachment rate reaches 90% and the growth density reaches 70%-80%, it is induced with DMED medium containing 10% (volume) horse serum.

[0064] 2. Determination of the effect of recombinant protein mmID2 on inhibiting cell differentiation and promoting cell proliferation: the recombinant protein mmID2 obtained in the above examples was diluted with PBS buffer containing 0.1% BSA and added to the above step 1) C2C12 cells induced by differentiation and containing 10% horse The cells were treated in DMED medium with serum at a final conce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of molecular biology and in particular relates to clam DNA (Deoxyribonucleic Acid) binding inhibitor mmID2 genes as well as encoding proteins and application thereof. The cRNA sequence of the clam mmID2 is shown as a nucleotide sequence shown in a sequence table SEQ ID No.1. The clam CDNA is amplified to total cRNA sequence 1017bp of the mmID2 by utilizing the clam EST sequence information, wherein the complete reading frame is 351bp and complete coding proteins contain 116 amino acids and have a typical basic helix-loop-helix (helix-loop-helix, HLH) structure. The mmID2 protein has an obvious effect on proliferation of animal cells. The mmID2 has wide application prospects in aspects of promoting cell proliferation and inhibiting cell differentiation and can serve as a growth addition factor for promoting shellfish cell proliferation to be used for establishing a cell culture system.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to a clam DNA binding inhibitor mmID2 gene, its encoded protein and its application. Background technique [0002] DNA-binding repressors are a class of transcriptional regulators that are widely expressed during biological development and belong to one of the members of the helix-loop-helix (HLH) transcription factor family. Activity acts as a negative regulator. bHLH transcription factors are a large family of widely distributed or tissue-specific proteins that bind to DNA in the form of homodimers or heterodimers, and can activate gene transcription related to cell differentiation. However, ID molecules, as members of the HLH family, lack DNA-binding domains and form inactive heterodimers with some transcription factors (mainly bHLH proteins), which can inhibit the binding of bHLH to the E motif on DNA or to other tissue-specific bHLH transcription factor b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N5/07C12N5/071C07K14/435
Inventor 王鸿霞郇聘岳欣刘保忠
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com