Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene

A blood coagulation factor and hemophilia technology, applied in the fields of life sciences and biology, can solve the problems of affecting the formation of FⅧ gene mRNA, lack of normal protein and severe hemophilia A, etc., saving manpower, simple and convenient operation, and improving amplification efficiency Effect

Inactive Publication Date: 2014-05-28
CHANGSHA ADICON CLINICAL LAB
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The molecular mechanism of the FⅧ gene inversion of its No. 1 intron is very similar to the molecular mechanism of the No. 22 intron inversion, which is essentially due to the high degree of homogeneity between the inside and outside of the FⅧ gene near the distal end at the genome level. Gene recombination occurs in the source sequence, thereby affecting the formation of FⅧ gene mRNA, resulting in a severe lack of normal protein and leading to the occurrence of severe hemophilia A

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene
  • Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene
  • Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A kit for in vitro diagnosis of the first intron of the coagulation factor VIII gene of hemophilia A, including: dNTP, 2*PCR buffer, MgCl 2 , Taq enzyme; multiple primers A liquid and B liquid mixed in a certain proportion; instructions for use.

[0051] Among them, MgCl 2 The final concentration of the reaction was 1.0mM, and the final concentration of the dNTP reaction was 3.0mM.

[0052] Solution A (tube I) includes: primers 9F (SEQ ID NO.1) q9R (SEQ ID NO.2), Intlh-2F (SEQ ID NO.3) for amplifying the Intlh-1 region of the FⅧ gene; its base sequence for:

[0053] SEQ ID NO.1: AGACTTTGGGGTTGTTGGGA

[0054] SEQ ID NO. 2: GCTCAAGCTAGGATGGCTCTGC

[0055] SEQ ID NO. 3: GGCAGGGATCTTGTTGGTAAA;

[0056] Solution B (tube II) includes: primers 9F (SEQ ID NO.1), Intlh-2F (SEQ ID NO.3), Intlh-2R (SEQ ID NO.4) for amplifying the Intlh-2 region of the FⅧ gene; The base sequence is:

[0057] SEQ ID NO.1: AGACTTTGGGGTTGTTGGGA

[0058] SEQ ID NO. 3: GGCAGGGATCTTGTTGGTAAA

...

Embodiment 2

[0064] Embodiment 2: the usage method of kit

[0065] 1) Sample DNA extraction (according to the instructions of Tiangen Blood / Cell / Tissue Gene DNA Extraction Kit): to extract DNA from human blood samples, the sample extraction method is as follows.

[0066] 1.1 Take 300uL of blood and add 900uL of red blood cell lysate, mix by inverting, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 10000rpm for 1 minute (if the maximum speed of the centrifuge is not allowed, centrifuge at 3000rpm for 5min), absorb the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed. Add 20 μl proteinase K solution and mix well.

[0067] 1.2 Add 200 μl buffer GB, mix well by inverting, place at 70°C for 10 minutes, the solution should become clear, centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0068] 1.3 Add 200 μl of absolute ethanol, shake and mix well fo...

Embodiment 3

[0092] Because hemophilia A is a sex-linked recessive genetic disease, the family inheritance is very obvious. For example, if a woman has hemophilia A, then the boy born must be hemophilia A, and the girl may be a carrier or hemophilia A, determined by the father's situation. Now in order to prove the reliability of the method we developed, we collected 6ml of blood samples from a hemophilia family clinically. The test members include: mother (for hemophilia), father (normal), daughter (unknown: presumed to be a carrier). According to the method for embodiment 2, detect: the result is as follows figure 2 , From the first tube reaction (int1h-1), it was found that the father's blood sample was confirmed to be a normal band: the electrophoresis band was 1.9kb. The mother's blood sample was confirmed to have intron 1 inversion of the FVIII gene, with a band of 1.3kb; the daughter was a carrier: the electrophoresis band contained both 1.9kb and 1.3kb. From the results of tub...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method, primers and a kit for detecting inversion of the first intron of hemophilia A clotting factor VIII gene. The primers comprise primers SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3 for amplifying the Intlh-1 region of the clotting factor VIII gene and primers SEQ ID NO. 1, SEQ ID NO. 3 and SEQ ID NO. 4 for amplifying the Intlh-2 region of the clotting factor VIII gene. The method and the kit can be utilized to simply, efficiently and specifically detect the inversion of the first intron of the hemophilia A clotting factor VIII gene.

Description

[0001] technical field [0002] The invention belongs to the field of life science and biotechnology, and particularly relates to a primer, a method and a kit for detecting the first intron of the coagulation factor VIII gene of hemophilia A, which can detect hemophilia A by long-segment PCR amplification technology. Inversion of the first intron of the coagulation factor VIII gene was detected. [0003] Background technique [0004] Hemophilia is a group of bleeding disorders caused by inherited coagulation factor deficiency, including hemophilia A (type A), hemophilia B (type B) and hereditary factor XI deficiency (type C). The former two are sex-linked recessive inheritance, and the latter is autosomal incomplete recessive inheritance. [0005] Hemophilia A is an X-chromosome-linked recessive genetic disease in which severe blood coagulation disorders are caused by genetic defects in blood coagulation factor VIII (Factor VIII, FⅧ). It can occur in both men and women, bu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686
Inventor 宋坤周晓犊王淑一孙翠莲
Owner CHANGSHA ADICON CLINICAL LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com