Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Laccase gene, engineering bacteria and application

A technology of genetically engineered bacteria and engineered bacteria, applied in the field of environmental biology, can solve the problem of discovering endogenous laccase, and achieve the effect of improving expression activity

Active Publication Date: 2016-03-30
ZHEJIANG SHUANGLIANG SUNDA ENVIRONMENTAL PROTECTION CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The fungi that secrete laccase mainly include Basidiomycetes, Polypores, Deuteromycetes, Ascomycetes, Neurospora, Podosporium and Aspergillus, and most of them are distributed in Basidiomycetes, followed by Ascomycetes. Most of them are white rot fungi of Basidiomycotina, but no endogenous laccase has been found in yeast

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laccase gene, engineering bacteria and application
  • Laccase gene, engineering bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Codon Optimization of Laccase Gene

[0022] According to the cotA gene sequence of Bacillus subtilis (GENEID: 936023), combined with the codon preference expressed by Pichia pastoris, the codon optimization of the cotA gene sequence was carried out, and restriction sites were introduced into the upstream and downstream of the full-length gene: EcoRI and NotI. At the same time, in order to prevent the optimized gene sequence from containing EcoRI restriction site and subsequent DNA linearization BglII restriction site, and adjust the GC content of the optimized gene, the 855th base A was mutated to G, and the 1098th base was mutated. The base T is mutated to C. The full length of the gene is 1542 bases, encoding 514 amino acids. The optimized laccase gene was named Tcot.

[0023] Design restriction sites and protective bases at both ends of the gene, and design primers as follows:

[0024] P1: ACGGAATTCATGACTTTGGAAAAGTTTGTTGATGCTTTGCCAATTCCAGATACTTTGAAGCCAGTTCAAC

...

Embodiment 2

[0056] Expression of Laccase Gene in Yeast Cells

[0057] 1. Construction of expression vector

[0058] The codon-optimized PCR product was digested with EcoRI / NotⅠ, the fragment was recovered, inserted into the same double digested Pichia constitutive expression vector pGAPZaA (Invitrogen, USA) with the correct reading frame, ligated, and transformed E. coli DH5α, the recombinant plasmid pGAPZaA-Tcot was obtained. The recombinant plasmid was verified by EcoRI / NotI double enzyme digestion.

[0059] 2. Preparation of competent cells for electroporation

[0060] In a 50ml centrifuge tube containing 5ml YPD, culture yeast cells overnight at 30°C; take 30~50ul of the overnight culture, inoculate a 250ml shaker flask containing 50ml of fresh medium, and grow overnight until OD600=1.3~1.5; at 4 degrees, 1500g Collect the cells by centrifugation for 5 minutes, and suspend the cells with 50ml pre-cooled sterilized water; centrifuge as above, suspend the cells with 25ml pre-cooled ...

Embodiment 3

[0076] Study on the Properties of Laccase

[0077] 1. Effect of pH value on laccase activity

[0078] Laccase was added to the buffer system with different pH values ​​to measure the enzyme activity, the pH was set from 2.0 to 10.0, and points were taken every 0.5 for measurement. The enzyme activity assay reaction was carried out at 25° C., and the reaction time was 15 minutes. The result is as figure 1 It was shown that the optimum pH value of laccase is 4.5~5.5, and in the range of pH4.0 to pH6.5, the enzyme activity of laccase can maintain more than 50%.

[0079] 2. Effect of temperature on laccase activity

[0080] The optimum reaction temperature of laccase was determined at the optimum pH value, the reaction time was 15min, the temperature was set from 15°C to 75°C, and points were taken every 5°C for measurement. The result is as figure 2 It shows that the optimum temperature of laccase is 25~35℃, and the enzyme activity can keep more than 60% at 20~45℃.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of environmental biology, and discloses a laccase gene, a laccase gene engineering bacterium and its application in microbial hydrolysis treatment of papermaking wastewater. Laccase gene, its nucleotide sequence such as SEQ? ID? As shown in NO:2, the protein encoded by the laccase gene has an amino acid sequence such as SEQ? ID? NO:1 shown. The laccase gene optimized according to the preferred codons of Pichia pastoris provided by the present invention can be efficiently constitutively expressed in yeast, can improve the expression activity of laccase, and is of great significance for promoting the application of laccase in the biological treatment of papermaking wastewater .

Description

technical field [0001] The invention relates to the field of environmental biology, in particular to a laccase gene, a laccase gene engineering bacterium and its application in microbial hydrolysis treatment of papermaking wastewater. Background technique [0002] Laccase is a protein that binds multiple copper atoms and belongs to the group of ceruloid oxidases. Laccase has a wide range of substrates and can treat various pollutants such as various phenolic dyes, substituted phenols, chlorophenols, thiophenols, bisphenols, and aromatic amines. Laccase is the most potential biological enzyme discovered in the paper industry in recent years, which has the ability to catalyze the oxidation of lignin. Laccase can selectively catalyze the degradation of lignin without producing toxic substances, and the production is carried out under mild conditions of normal temperature and normal pressure, saving equipment and energy consumption. Therefore, laccase has a very great applicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/10C12N1/19C02F3/34C12R1/125C12R1/84C02F103/28
Inventor 郑展望杨瑾
Owner ZHEJIANG SHUANGLIANG SUNDA ENVIRONMENTAL PROTECTION CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com