Method for synthesizing double-stranded RNA used for inhibiting growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes
A synthesis method and a technology for the diploid borer, which are applied in the field of agricultural biology, can solve the problems of difficult control of spraying pesticides, and achieve the effects of reducing mechanical damage and facilitating experimental operations.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1a
[0023] Example 1 Acyl-CoA desaturase SexiVPAE gene fragment acquisition
[0024] The cDNA clone of the acyl-CoAdesaturase SexiVPAE gene was provided by Professor Hua Hongxia from the School of Plant Science and Technology, Huazhong Agricultural University. The sequence of the cDNA clone is shown in SEQ ID NO.1. The sequence fragment of this cDNA clone was used for homology comparison on http: / / www.ncbi.nlm nih gov / , and it was annotated as acyl-CoA desaturase SexiVPAE gene.
[0025](1) According to the sequence of the acyl-CoA desaturase SexiVPAE gene fragment, use Primer Premier3.0 software to design gene-specific upstream and downstream primers, and then add the sequence TAATACGACTCACTATAGG of the T7 promoter to the 5' end of the upstream and downstream primers;
[0026] Upstream primer (P1): GGCACTACGCTTATCCTGTGA (SEQ ID NO.3)
[0027] Downstream primer (P2): CCGCGTTAGTGTCGCTAAAT (SEQ ID NO.4)
[0028] Upstream primer plus T7 promoter (P3): 5'TAATACGACTCACTATAGGGGCACTACG...
Embodiment 2
[0044] Example 2.In vitro transcription of RNA and synthesis and purification of dsRNA
[0045] (1) Using the recovered two PCR products as templates, use T7RiboMAX TM The Express RNAi System Kit (Promega) was used to transcribe RNA in vitro, and the transcription conditions were as follows:
[0046]
[0047] 42°C water bath for 1h. Then the two tubes of transcription products were mixed in equal volumes, placed in a dry bath at 70°C for 10 minutes, and then cooled slowly to room temperature (20 minutes). Add 1 μL of 1:200 diluted RNase Solution and 0.5 μL of RQ1 RNase-Free DNase (T7RiboMAX TM Express RNAi System kit comes with), 37°C for 30min. Add 0.1 volume of 3M NaAC and 1 volume of isopropanol, mix and place on ice for 5 min, and centrifuge at 13000 rpm for 10 min. Discard the supernatant, add 0.5 mL of 75% ethanol, and centrifuge at 13,000 rpm for 5 min. Remove the supernatant, air-dry at room temperature for 15 min, add 200 μL nuclease-free water to dissolve. ...
Embodiment 3
[0059] Embodiment 3.dsRNA feeding experiment
[0060] The configuration of the artificial feed for Chilo suppressalis refers to the formula published by Liu Huimin and Zhang Guoan (2008). Casein 10.00g, yeast powder 18.75g, cellulose 7.50g, sucrose 15.00g, glucose 7.50g, vitamin C 7.50g, multivitamin B 3.00g, cholesterol 0.375g, choline chloride 0.25g, Beck's salt 2.50g , sorbic acid 1.35g, agar 13.49g and tap water 809.25g.
[0061] Weigh the prepared various feed ingredients respectively, put them into a container and mix them evenly. Simultaneously take agar by weighing 10% of the formula total dry matter weight (expressed in G), put into another container that fills 6 times of DEPC H of G, add the sorbic acid of 1% G after heating and melting, stir and make When the temperature drops to 60°C, add Beck's salt solution, choline chloride and cholesterol respectively, and finally add an appropriate amount of purified dsRNA solution to make the final concentration reach 50ng / ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com