Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Laccase generation cerrena and application thereof

A kind of tooth hairy fungus, one color technology, applied in the direction of fungi, oxidoreductase, immobilized on or in the inorganic carrier, etc., can solve the problems of low laccase level, slow growth of bacteria, low enzyme catalytic efficiency, etc.

Active Publication Date: 2013-09-18
BEIJING UNIV OF AGRI
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many problems, such as the low level of laccase synthesized by the strain, the slow growth of the bacteria, the low catalytic efficiency of the enzyme, and it is not suitable for industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Laccase generation cerrena and application thereof
  • Laccase generation cerrena and application thereof
  • Laccase generation cerrena and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1. Isolation and Identification of Cerrena unicolor GSM-01CGMCC No.7713

[0048] 1. Isolation of Cerrena unicolor GSM-01CGMCC No.7713

[0049] Two pure culture strains were obtained by tissue isolation from the fruiting bodies of the green plant Ligustrum sinense between No. 2 and No. 3 office buildings of Beijing Agricultural College, and the numbers were GSM-01 and GSM-10, respectively.

[0050] 2. Identification of Cerrena unicolor GSM-01CGMCC No.7713

[0051] Using the genomic DNA of bacterial strains GSM-01 and GSM-10 as templates, ITS sequences were amplified by PCR with ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3'), and the ITS sequences amplified by the bacterial strain GSM-01 were as follows: SEQ ID No.1, the ITS sequence amplified from strain GSM-10 is shown as SEQ ID No.2. The identity of strain GSM-01 and GSM-10 was 98.26%.

[0052] The morphological characteristics of fruiting bodies of strains GSM-01 and GSM-10 are as follow...

Embodiment 2

[0055] Example 2, Study on the Enzyme Production Characteristics of Liquid Fermentation of Cerrena unicolor GSM-01CGMCC No.7713 and Cerrena unicolor GSM-10

[0056] 1. Liquid fermentation

[0057] Cerrena unicolor (Cerrena unicolor) GSM-01CGMCC No.7713 and Cerrena unicolor (Cerrena unicolor) GSM-10 were separately inoculated in PD medium, shaken at 25°C, 180rpm (rotation radius: 20mm) for 5 days, as Seed solution; 5% (v / v) inoculum amount inoculates 100ml of PD medium in a 500ml Erlenmeyer flask, shakes at 25°C and 180rpm (rotation radius: 20mm) for 6 days, centrifuges at 12,000rpm at 4°C for 15min, collects the precipitate For the mycelia, the supernatant is collected to obtain a fermentation broth, and the obtained mycelium is ground into a homogenate for later use. Obtain Cerrena unicolor GSM-01CGMCC No.7713 mycelium, Cerrena unicolor GSM-01CGMCC No.7713 fermentation broth, and Cerrena unicolor GSM-10 mycelium respectively Body and Cerrena unicolor GSM-10 fermentation bro...

Embodiment 3

[0064] Example 3. Laccase produced by liquid fermentation of Cerrena unicolor GSM-01CGMCC No.7713

[0065] This embodiment has tested five kinds of liquid fermentation media, are respectively 0mmol / L Cu 2+ Medium, 1.0mmol / L Cu 2+ Medium, 2.0mmol / L Cu 2+ Medium, 5.0mmol / L Cu 2+ Medium and 10mmol / LCu 2+ Medium. 0mmol / L Cu 2+ The medium is PD medium. 1.0mmol / L Cu 2+ The medium is to add 1.0mol / L CuSO to PD medium 4 solution to Cu 2+ The liquid obtained at a final concentration of 1.0 mmol / L. 2.0mmol / L Cu 2+ The medium is to add 1.0mol / L CuSO to PD medium 4 solution to Cu 2+ The liquid obtained at a final concentration of 2.0 mmol / L. 5.0mmol / L Cu 2+ The medium is to add 1.0mol / LCuSO to PD medium 4 solution to Cu 2+ The liquid obtained with a final concentration of 5.0 mmol / L. 10mmol / L Cu 2+ The medium is to add 1.0mol / L CuSO to PD medium 4 solution to Cu 2+ The liquid obtained with a final concentration of 10 mmol / L.

[0066] Cerrena unicolor (Cerrena unicolor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a laccase generation cerrena and an application thereof. The laccase generation cerrena is Cerrena unicolor GSM-01, and the registration serial number of the Cerrena unicolor at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms is CGMCC No.7713. As shown in experiments, the Cerrena unicolor GSM-01CGMCC No.7713 of the invention is shake cultivated in a PD culture medium for 6 days at 25 DEG C and at a rotating speed of 180rpm (the rotating radius is 20mm), the laccase activity of per ml fermentation broth is 965.42+ / -13.71U, and the laccase activity of each mg (wet weight) of mycelium is 2822.71+ / -312.33U.

Description

technical field [0001] The invention relates to a strain of laccase-producing tooth hair fungus and its application. Background technique [0002] White rot fungi belong to the Basidiomycota phylum (Basidiomycota) and have their unique lignin-degrading enzyme system. They get this name because they saprophyte on wood or trees, causing the wood to turn white and rot. Currently, the most studied white rot fungi are: Coliolus versicolor, Phanerochaete chrysosporium, Trametes versicolor, Phlebia radiata, Vermilion Pycnoporus cinnabarinus, Pleurotus pulm onarius, Trametes versicolor, Pleurotus, etc. There are three main types of lignin-degrading enzymes secreted by white-rot fungi, namely lignin peroxidase, manganese peroxidase and laccase. [0003] Laccase (Lac for short) is a copper-containing polyphenol oxide, which was first discovered in the secretions of sumac trees, and later found in some higher fungi, plants, insects and bacteria. Utilizing laccase can degrade organic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12N11/14C12N9/02C12R1/645
Inventor 张国庆陈青君崔凯王子健王珊珊赵晓萌
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com