Fusion protein capable of activating tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in targeted mode, recombinant vector and application of recombinant vector

A technology for recombining vectors and signaling pathways, applied in applications, recombinant DNA technology, DNA/RNA fragments, etc., can solve problems such as side effects and lethality, and achieve the effect of avoiding side effects and great commercial value

Inactive Publication Date: 2012-12-05
JINAN UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Under normal circumstances, when choosing TRAF6 to treat the above diseases, the first choice is to use the corresponding ligand to activate the upstream receptor of TRAF6. However, TRAF6 can transmit signals from multiple receptors on the cell surface, and these receptors are expressed on a variety of cells. When the receptor ligand is used to activate the TRAF6 signaling pathway, it often causes many side effects, and some are even fatal
[0004] Therefore, it is necessary to modify TRAF6 so that it not only retains the function of TRAF6, but also overcomes its side-effect-causing defects.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein capable of activating tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in targeted mode, recombinant vector and application of recombinant vector
  • Fusion protein capable of activating tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in targeted mode, recombinant vector and application of recombinant vector
  • Fusion protein capable of activating tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in targeted mode, recombinant vector and application of recombinant vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] (1) Preparation of recombinant vector pENTR-2B-Gyrase B-HA

[0040] ① Obtain the Gyrase B gene by PCR reaction, and the primers (both 5'-3', synthesized by BGI) are as follows:

[0041] FP: ATCGGAATTCATGTCGAACTCTTTATGACTCCTCC;

[0042] RP: ATCCACTAGTTTAAGCGTAATCTGGAACATCGTATGGGTAGCCTTCATAGTGGAAGTGGTCTTC.

[0043] Mix the PCR reaction solution according to the following system:

[0044]

[0045]

[0046] The PCR reaction was performed according to the following procedures: initial denaturation at 94°C for 2 min; denaturation at 94°C for 15 sec, refolding at 55°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; 72°C for 10 min.

[0047] ② Add 2.5 times the volume of frozen absolute ethanol to the PCR product obtained in step ① (add 0.1 times the volume of 3M sodium acetate at pH 5.6 at the same time) to precipitate, and the precipitate is formulated according to the following reaction system:

[0048] PCR precipitate

[0049]

[0050] The above reaction s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a fusion protein capable of activating a tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) signal path in a targeted mode, a recombinant vector and application of the recombinant vector. The fusion protein has an amino acid sequence shown as SEQ ID No.1 and is obtained by replacing the C terminal of a mouse TRAF6 with a section of gyrase B sequence; a gene for coding the fusion protein has a nucleotide sequence shown as SEQ ID No.2; and after the fusion protein is introduced into a cell, the cell can be continuously stimulated by a micromolecular medicine coumermycin, and the signal path on which the TRAF6 depends is activated in a targeted mode, so that side effects caused by the reason that diseases are treated by activating the TRAF6 signal path through ligands of receptors can be avoided. The recombinant vector has the nucleotide sequence shown as SEQ ID No.2, and has extremely important value for the functional research of the TRAF6 and the treatment research of diseases caused by the TRAF6.

Description

technical field [0001] The invention relates to the construction of a fusion protein, in particular to a fusion protein capable of targeting and activating the TRAF6 signaling pathway, its recombinant vector and its application. Background technique [0002] Tumor necrosis factor receptor-associated factor 6 (TNF receptor-associated factor 6, TRAF6) is a signaling molecule in cells, which has extensive and extremely important physiological functions. TRAF6 is essential for tooth formation, lymph node formation, and osteoclast formation; TRAF6 can guide the formation of thymic medulla microstructure to control the body's central immune tolerance; TRAF6 is a key factor in the production of regulatory T lymphocytes; TRAF6 It plays an important role in innate immunity and acquired immune response; TRAF6 is essential for the formation and maintenance of B cell follicles in secondary lymphoid organs; TRAF6 is also an important signal transduction molecule in inflammatory response ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N15/867C12N15/66
Inventor 秦俊文谢琪璇蔡冬青秋山泰身井上纯一郎禹艳红齐绪峰武征
Owner JINAN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products