Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Plant low-temperature resistance related protein, its encoded gene and application

A technology encoding genes and proteins, applied in the fields of plant gene improvement, application, plant peptides, etc., can solve the problems of difficult plant low temperature resistance, complex plant stress resistance traits, etc., and achieve high practical application value and improve the effect of stress resistance.

Inactive Publication Date: 2012-05-30
INST OF BOTANY CHINESE ACAD OF SCI
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the complexity of plant stress resistance traits, it is very difficult to improve the low temperature resistance of plants using traditional breeding methods
Genetic engineering methods such as transgenics provide an effective way for plant cold resistance breeding, but the isolation of high-efficiency cold resistance genes is the key factor limiting plant cold resistance genetic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant low-temperature resistance related protein, its encoded gene and application
  • Plant low-temperature resistance related protein, its encoded gene and application
  • Plant low-temperature resistance related protein, its encoded gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1. Acquisition and functional verification of proteins related to plant low temperature tolerance and their coding genes

[0051] 1. Acquisition of proteins related to plant low temperature tolerance and their coding genes

[0052] 1. Plant material processing and total RNA extraction

[0053] Leymus chinensis (Jisheng No. 1, purchased from the Leymus chinensis station in Jilin Province) seedlings were used as materials, treated at 4°C for 2 hours, total RNA was extracted, and detected by 1% agarose gel electrophoresis. The results were as follows: figure 1 shown. The extracted RNA has two obvious electrophoresis bands, which are 28S RNA and 18S RNA from top to bottom, indicating that the total RNA with higher purity and integrity has been obtained.

[0054] 2. Obtaining the full-length cDNA sequence of Leymus chinensis LcWRKY5 gene and PCR detection

[0055] The 3' end sequence of Leymus chinensis WRKY transcription factor was sequenced by GS-FLX 454 (abbrevia...

Embodiment 2

[0074] Embodiment 2, Analysis of low temperature tolerance of transgenic LcWRKY5 gene Arabidopsis plants

[0075] 1. Obtaining transgenic Arabidopsis plants with LcWRKY5 gene

[0076] Primers were designed according to the LcWRKY5 gene amplified in Example 1 above, and BamHI and SmaI restriction sites were added. The primer sequences were as follows:

[0077] Primer 3: CG GGATCC ATGGAAACGGCGCGGTGGTCG (the underline is the BamHI site) (sequence 3 in the sequence listing),

[0078] Primer 4: TCC CCCGGG ATAATCCGGCAGCTTCCGCAGG (the underline is the SmaI site) (sequence 4 in the sequence listing),

[0079]Using the artificially synthesized LcWRKY5 gene shown in Sequence 2 in the Sequence Listing as a template, PCR amplification was performed, and the amplified PCR product was cloned into pMD19-T Simple (TaKaRa Company) vector, named pMD19-LcWRKY5. Digest pMD19-LcWRKY5 with BamHI and SmaI to recover a fragment of about 1 kb. At the same time, use BamHI and SmaI to double diges...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses plant low-temperature resistance related protein, its encoded gene and application. The plant low-temperature resistance related protein provided in the invention is protein of (a) or (b) as the following that: (a) is protein composed of amino acid sequences as shown in sequence 1 of a sequence table; (b) is plant low-temperature resistance related protein that is derived from (a) and is obtained by substitution and / or deletion and / or adding of one or several amino acid residues in amino acid residue sequences as shown in sequence 1 of the sequence table. Experiments prove that, LcWRKY5 has tissue expression specificity, and under low-temperature induced expression, can participate in a response of Leymus chinensis to multiple kinds of adversity stress so as to improve stress resistance of plants. LcWRKY5 and its encoded gene are of great theoretical and practical significance for cultivating low-temperature resistance improved Leymus chinensis and other new plant varieties, and can be used for cultivating and identifying resistant plant varieties needed in agriculture and animal husbandry as well as ecological environment improvement, thus boasting high practical application value.

Description

technical field [0001] The invention relates to a protein related to low temperature resistance of plants in the field of biotechnology, its coding gene and application. Background technique [0002] Low temperature stress is one of the main obstacles to the normal growth of plants. The low temperature resistance of plants, especially economic crops, directly affects crop yield. At present, the identification of cold resistance genes is mostly focused on model plants such as Arabidopsis and rice, as well as important crops such as corn and cotton. Most of them are plants of tropical origin, and they cannot tolerate cold environments, and they will cause damage at 0°C to 12°C. Therefore, there is an urgent need to excavate related genes from other plants with strong low temperature resistance. my country is one of the countries with the richest biodiversity in the world and one of the origin centers of major crops. Not only are there many types of plant genetic resources, b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11A01H5/00
Inventor 刘公社赵爱国程丽琴李晓峰陈双燕齐冬梅
Owner INST OF BOTANY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More