Multifunctional slow virus carrier capable of restraining endogenesis target genes and simultaneously expressing exogenous genes
A lentiviral vector and exogenous gene technology, applied in genetic engineering, plant genetic improvement, biochemical equipment and methods, etc., can solve problems such as off-target effects and siRNA difficulties, and achieve the effect of improving curative effect and eliminating negative effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1: Construction of α-ACTN1 shRNA expression cassette:
[0045] The predicted human α-ACTN1 shRNA target sequence is 5’GGGACACAGATCGAGAACATCGAAGAG( Figure 7 ). Design a pair of complementary oligonucleotides with the following sequences:
[0046] A1:
[0047] 5’-CTAGAGGGACACAGATCGAGAACATCGAAGAGTTCAAGAGACTCTTCGA TGTTCTCGATCTGTGTCCCTTTTTC
[0048] A2:
[0049] 5'TCGAGAAAAAGGGACACAGATCGAGAACATCGAAGAGTCTCTTGAACTCTTCGATGTTCTCGATCTGTGTCCCT
[0050] Mix the pair of primers A1 / A2 in equal amounts, denature at 95°C for 5 minutes, and cool and anneal naturally. Ligated with the lentiviral vector PU2-FH digested with XbaI / XhoI to obtain the plasmid PU2-α-ACTN1shRNA.
Embodiment 2
[0051] Embodiment 2: Construction of anti-RNAi human α-ACTN1 (rr-α-ACTN1) cDNA ( Figure 7 )
[0052] According to the siRNA target sequence, without affecting the amino acid sequence, design primers containing 4 point mutations, the sequence is as follows:
[0053] (1); 5'-AGAGAATTCCATGGACCATTATGATTCTCAGCAAAC,
[0054] (2); 5'-CCTCTTCAATATTTTCAATCTGTGTCCCCGCCTTCCGGAG,
[0055] (3); 5'-CACAGATTGAAAATATTGAAGAGGACTTCCGGGATGGCCTG,
[0056] (4); 5'-CTCGGTACCGGTGAGGTCACTCTCGCCGTACAG,
[0057] Using the plasmid GC-Z6382 (purchased from genecopoeia) as a template, the N-terminal fragment (N-ter) of rr-α-ACTN1 was amplified with 1 and 2 primers, and the C-terminal fragment (C-ter) was amplified with 3 and 4 primers Amplify, and then use ligation PCR to use 1, 4 as primers, and two purified mixed PCR product fragments as templates to amplify the full-length rr-α-ACTN1, which is digested with EcoRI / AgeI and cloned into the same EcoRI / AgeI In the lentiviral plasmid PU2-α-ACTN1 shRNA...
Embodiment 3
[0061] Example 3: Production and introduction of lentivirus
[0062] 293T cells (purchased from ATCC) were cultured in a petri dish with a diameter of 10 cm, and the packaging plasmid pHR'8.2deltaR / pCMV-VSV-G (purchased from addgene) was used in a ratio of 8:1 (the total DNA amount was 5 μg) respectively. Co-transfect with two lentiviral recombinant plasmids: PU2-α-ACTN1 shRNA, PU2-α-ACTN1 shRNA+rr-α-ACTN1+GFP (5 μg each), replace the culture medium after 24 hours, and start from transfection the next day The virus-containing culture fluid was collected from the 293T cells and filtered through a 0.45 μm filter to remove residual 293T cells. When infecting Jurkat T cells (purchased from ATCC), mix the virus with an equal volume of fresh medium, add protamine sulfate (final concentration of 10 μg / ml, Sigma), and culture the cells for 6 hours or overnight, then replace with fresh medium without After 24 hours, puromycin was added to the virus culture solution for selection until...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com