Molecular markers and their application to predict the efficacy of platinum-based chemotherapy in advanced non-small cell lung cancer
A technology of non-small cell lung cancer and molecular markers, applied in the field of medical molecular genetics and clinical medicine, can solve the problems of different sensitivity and curative effect of chemotherapy drugs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] Example 1. Molecular markers for predicting efficacy of platinum-based chemotherapy in patients with advanced NSCLC.
[0019] 1. Collection of clinical samples
[0020] The subjects of the study were 663 patients with newly diagnosed non-small cell lung cancer. The inclusion criteria are: new pathologically confirmed
[0021] Patients with non-small cell lung cancer; age over 18 years; stage IIIA-IV, with measurable lesions; no history of other malignant tumors, no previous chemotherapy, surgery and radiotherapy for non-small cell lung cancer; receiving first-line platinum-based chemotherapy; general health Status score PS 0-2; no major organ dysfunction, blood routine, liver and kidney function and heart function are basically normal; complete follow-up information can be obtained. All the subjects were unrelated Han people, geographically mainly from Shanghai and its surrounding areas. All patients received platinum-based first-line treatment for the first time.
...
Embodiment 2
[0032] Example 2. Use of detection kits.
[0033] 1. Genomic DNA extraction
[0034] Genomic DNA was extracted by the guanidine hydrochloride method.
[0035] 2. Molecular marker typing
[0036] Using the detection kit, first specifically amplify the containing ABCB11The DNA fragment of the polymorphic site of gene rs12692889, the primer sequence is as follows: forward primer-5' TCTTTGGCTGTTTGGAAATA 3' (SEQ ID NO.1); reverse primer-5' GCAACCCTTTAACCAGAAAA 3' (SEQ ID NO.2). The reaction system (20 μl) contains: 10 x Taq buffer 2 μl, 2 mM dNTP 2 μl, 1 U Taq enzyme 1 μl, sample DNA (about 50 ng) 1 μl and 5 μM PCR primer 1 μl. The amplification reaction was carried out on a PCR amplification instrument, and the reaction conditions were: 95°C for 5 minutes; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; 72°C for 7 minutes; and storage at 4°C.
[0037] The obtained DNA fragments are then sequenced. Specific steps are as follows:
[0038] PCR...
Embodiment 3
[0044] Example 3. The service of predicting the efficacy of chemotherapy for patients with advanced NSCLC.
[0045] 1. Genomic DNA extraction
[0046] Peripheral blood samples were collected, and genomic DNA was extracted by the guanidine hydrochloride method.
[0047] 2. Genotyping detection
[0048] Using the kit provided by the invention, the detection of the genome DNA of the detected ABCB11 Genome rs12692889 site for typing.
[0049] 3. Predictive analysis of the curative effect of individual platinum-containing chemotherapy
[0050] Through the analysis of the genotype of the rs12692889 locus of the tested subjects, an evaluation and analysis report for the efficacy of individual platinum-based chemotherapy is issued: if the genotype is C / C, the effective rate is 14.2%; if the genotype is C / T, the effective rate is 14.2%. The effective rate is 21.7%; if the genotype is T / T, the effective rate is 36.8%. The results can be used as a reference for physicians to adjust ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap