Method for detecting target genes in plants and special SPR biosensor thereof
A biosensor and target gene technology, applied in a method for detecting target genes in plants and its special SPR biosensor field, can solve the problems of biodiversity destruction, insect resistance enhancement, and reduction of natural enemies, and achieve high Sensitivity, easy-to-operate effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] Embodiment 1, preparation and verification of SPR biosensor
[0064] The principle of SPR detection of the coding gene Cry1Ac of Bt protein: use BIAcore3000 (GE Company) designed based on the principle of surface plasmon resonance (SPR) to detect whether the sample contains Cry1Ac gene, the chip selected is SA chip, which is characterized in carboxylation The surface of the dextran is covered with a layer of streptavidin, which is very suitable for capturing biotin-labeled DNA fragments, so when designing probes, biotin can be labeled at its 5' end. Due to the high affinity between streptavidin and biotin, when the probe flows into the chip surface, it will be bound to the chip surface as a ligand (ligand), and the sample will flow through the chip surface at a constant flow rate and concentration, if The analyte (analyte) in the sample and the ligand coupled on the chip will undergo base pairing, the mass of the chip surface substance will change, and the instrument wi...
Embodiment 2
[0103] Embodiment 2, SPR biosensor detection target gene
[0104] 1. Sample preparation
[0105] The above experiments discussed the issues that need to be paid attention to in SPR detection from various aspects, and provided a basis for the subsequent detection of transgenic genes.
[0106] In the experiment, the genomes of wild-type cotton DP5415 and transgenic cotton Nucotn33B were extracted using a plant genome rapid extraction kit (Novascience, Dg05020). Using them as templates, PCR amplification was performed with primers BtFW1 and BtRV1 respectively; Product and PCR product of transgenic cotton Nucotn33B.
[0107] In addition, in order to analyze whether the chip has specificity in detecting PCR products, a negative control was designed, that is, using primers BtFW2 and BtRV2 (BtFW2: 5'CGGTTACACTCCCATCGACATCTCC 3'; BtRV2: 5'TTGAATTGAATACGCATTTCCTCGC 3') to transgenic cotton Nucotn33B genome PCR amplification was performed as a template to obtain a control PCR product....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap