Bacillus anthracis detection kit and using method of kit
A technology of Bacillus anthracis and detection kit, which is applied in the directions of biochemical equipment and methods, determination/inspection of microorganisms, etc., can solve the problems of easy cross-contamination operation process, increasing the difficulty of popularization and application, complex quantitative determination instruments, etc., Achieving fast and efficient amplification, reducing the possibility of aerosol contamination, and easy identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] The preparation of embodiment 1 kit
[0065] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0066] Outer primer F3:
[0067] CTGATAGTCAAACGAGAACAA
[0068] Outer primer B3:
[0069] AGTTTCTTTCCCCTGCTAGA
[0070] Inner primer FIP:
[0071] CGCATGCACTTCTGCATTTCTTTTAATACTTCTACAAGTAGGACACAT
[0072] Inner primer BIP:
[0073] TCGTTCTTTGATATTGGTGGGAGTTTTTTGATAGTGAATGATCAATTGCGAC.
[0074] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;
[0075] (3) Prepare reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 0.2 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3 are placed in the container;
[0076] (4) Prepare the sample pretreatment solution: the sample pretreatment solution contains 20 mmol / L Tris-H...
Embodiment 2
[0087] Example 2 Application of Bacillus anthracis Detection Kit
[0088] 1 Materials and methods
[0089] 1.1 Materials
[0090] 1.1.1 Strains
[0091] The present invention adopts 16 bacterial strains, which are mainly derived from the Academy of Military Medical Sciences, clinical isolated bacterial strains and environmental isolated bacterial strains. See Table 1 for details.
[0092] strain source
Strain and serial number
Military Medical Academy
Bacillus anthracis
Clinical isolates
Derived from 5 strains of Bacillus anthracis in the test sample;
other strains
2 strains of Bacillus subtilis, 2 strains of Bacillus cereus, 2 strains of Bacillus thuringiensis, 2 strains of Bacillus brown nigeri, 1 strain of Brucella, and 1 strain of Yersinia pestis.
[0093] 1.1.2 Main instruments and reagents
[0094] 1.2 Identification of isolated strains
[0095] 1.2.1 Cultivation of Bacillus anthracis Bacillus anthracis puncture-c...
Embodiment 3
[0122] Example 3 Bacillus anthracis detection kit using reaction tube
[0123] The Bacillus anthracis detection kit of this embodiment uses the same reagents and primers as in Example 1. The kit also includes a reaction tube, which is composed of a tube body and a tube cover. The lower part of the inner cavity of the tube is provided with a A vertically extending partition that separates two cavities A and B, wherein: Cavity A is filled with 22.0 μL of LAMP reaction solution and 0.5 μL of Bst For DNA polymerase, the upper layer of the liquid is sealed with paraffin; cavity B is filled with 2.0 μL of LAMP reaction chromogenic solution, and the upper layer of the liquid is also sealed with paraffin, and the reaction tube is stored at -20°C.
[0124] In this embodiment, a reaction tube is used as a container to carry out LAMP detection on Bacillus anthracis, and a positive control group and a negative control group are provided at the same time, which specifically includes the ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com