siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application

A ferroportin and recombinant lentivirus technology, applied in the fields of molecular biology, biomedicine and genetic engineering, to achieve the effects of regulating metabolism and absorption, regulating serum iron levels, and treating iron metabolism-related diseases

Inactive Publication Date: 2013-06-12
THE HONG KONG POLYTECHNIC UNIV SHENZHEN RES INST
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, HP is highly expressed in the colon, which plays little role in iron absorption

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application
  • siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application
  • siRNA recombinant slow virus for inhibiting human hephaestin gene expression and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] According to the human ferroportin auxiliary protein gene (HEPH) sequence (NM_000617.2), the template strand and coding strand were designed. Add BglII and XhoI restriction sites to the 5' end respectively, and send the sequence to Invitrogen Company for synthesis. After screening, the HEPH interference fragment sequence of the present invention with the most significant interference effect is obtained as follows: preferred embodiment

[0043] Template strand (Seq ID No.2):

[0044] 5’-GATCCCCAGGGGTGGATAAAGAATTCTTCAAGAGAGAATTCTTTATCCA

[0045] CCCCTTTTTTTA-3'

[0046] Coding chain (Seq ID No.3):

[0047] 5’-AGCTTAAAAA AGGGGTGGATAAAGAATTC TCTCTTGA

[0048] AATTCTTATCCACCCCT GGGG-3'

[0049] Retro-HEPHi system construction

[0050] The synthesized HEPH interference fragments (Seq ID No.2 and Seq ID No.3) were annealed. Specific steps are as follows:

[0051] 1. Establish an annealing system

[0052] 5ul 10x annealing buffer

[0053] 2nmole template chain Seq ID ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides small-interference RNA for inhibiting human hephaestin (HEPH) gene expression. The small-interference RNA is reversely complemented with human HEPH mRNA, and the length of the small-interference RNA is 19 to 27bp. The invention further discloses a DNA sequence for coding the corresponding shRNA of the small-interference RNA and recombinant slow virus capable of expressing the shRNA. The small-interference RNA, the DNA for coding the shRNA and the recombinant slow virus can effectively inhibit in vivo human HEPH expression, inhibit the release and metabolism of iron and adjust the serum iron level in vivo so as to fulfill the purpose of treating iron metabolism related diseases.

Description

technical field [0001] The invention relates to the technical fields of molecular biology, biomedicine and genetic engineering, in particular to the construction of a lentivirus interference system (Retrovirus) for the human ferroportin auxiliary protein gene (HEPH) by using the RNA interference technology mediated by the lentivirus (Retrovirus). -Heph), and its application in the preparation of medicines for disorders of iron metabolism. Background technique [0002] RNAi refers to the phenomenon that when a double-stranded RNA homologous to an endogenous mRNA coding region is introduced into a cell, the mRNA is degraded and gene expression is silenced. [0003] In 2001, Tuschl et al. introduced short siRNA into mammalian cells and thereby solved the interferon effect caused by introducing long double-stranded RNA into mammalian cells, thereby expanding the application prospects of RNAi in gene therapy. The RNAi mechanism is ubiquitous in organisms, so it is considered to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N7/01A61K48/00A61P25/28A61P25/16C12R1/93
Inventor 钱忠明葛啸虎柯亚
Owner THE HONG KONG POLYTECHNIC UNIV SHENZHEN RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap