Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Adeno-associated virus carrier, preparation method thereof and application

A virus vector and virus technology, applied in the field of biomedicine, can solve problems such as difficulty in popularization, complicated AAV vector production and purification technology

Inactive Publication Date: 2010-02-10
吴沛宏 +3
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the production and purification technology of AAV vectors is complicated, requires high technology and experience, and is difficult to promote

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adeno-associated virus carrier, preparation method thereof and application
  • Adeno-associated virus carrier, preparation method thereof and application
  • Adeno-associated virus carrier, preparation method thereof and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 The method for constructing the adeno-associated virus vector of the present invention

[0040] 1. Design and screening of siRNA target sequences capable of interfering with the expression of hepatitis B virus surface antigen-encoding genes: We first determined that the length of the siRNA target sequence was 19-22 bases, and the screening principle was to be able to specifically encode hepatitis B virus The mRNA transcribed by the surface antigen gene is paired and combined, and can selectively degrade it, resulting in down-regulation and inactivation of the expression product of the surface antigen gene of the hepatitis B virus. According to the base sequence of the surface antigen coding gene in hepatitis B virus, we searched for multiple target sequences with lengths of 19, 20, 21, and 22 bases, respectively. The most effective target site UUACUAGUGCCAUUUGUUC and siRNA sequence capable of interfering with the expression of hepatitis B virus surface antigen...

Embodiment 2

[0051] There are differences in the efficiency of different shRNA artificial genes to interfere with the expression of HBsAg.

[0052] We respectively constructed artificial genes that use H1 or U6 as promoters and carry different siRNAs that encode genes targeting HBsAg, that is, shRNA1: SEQ ID NO.2 (GATCCCCCCTACTAGTGCCATTTGTTTCTTCAAGAGAGAACAAATGGCACTAGTAATTTTTGGAAA) or shRNA2: SEQ ID NO. 3 (GATCCGTTACTAGTGCCATTTGTTCTTCAAGAGAGAACAAATGGCACTAGTAAACTTTTTTGGAAA) eukaryotic expression vector, we named pSilencer3.1-H1-HBVSAg-shRNA1, pSilencer3.1-H1-HBVSAg-shRNA2, pSilencer3.1-U6-HBVSAg-shRNA1, pSilencer3.1-U6-HBVSAg -shRNA2. In order to detect the interference efficiency of two artificial genes on the expression of hepatitis B virus surface antigen. We used liposomes to transfer 2 μg of expression plasmids encoding HBsAg (positive control), 2 μg of expression plasmids encoding HBsAg and 2 μg of shRNA encoding HBsAg expression (experimental group) 239 cells cultured in a 6-well pl...

Embodiment 3

[0057] The expression vector is selectively expressed in the liver.

[0058] Using the method of hydrodynamic transfection, 20 μg of the expression plasmid encoding the firefly fluorescent protein (Luc) reporter gene dissolved in 2 ml of normal saline was injected into the tail vein of the small white mouse, and after 24, 48 and 96 hours, respectively, the The small animal imaging system was used to observe the expression level and location of the reporter gene, and it can be seen that the Luc gene can be expressed at a high level in the liver area (see image 3 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an adeno-associated virus carrier comprising target sites capable of effectively disturbing the surface antigen expression of hepatitis B virus, a relevant sequence, a coding gene (shRNA) sequence for coding the surface antigen siRNA of the hepatitis B virus, manual a interferon coding genes and an expression box for regulating and controlling the manual a interferon codinggenes by different promoters. The adeno-associated virus carrier thoroughly combines shRNA and a interferon and can restrain the replicating capability of the hepatitis B virus and the multiplicationof liver cancer cells. The invention also provides a preparation method and the application of the adeno-associated virus carrier.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to an adeno-associated virus vector capable of inhibiting the replication ability of hepatitis B virus and the growth and metastasis of liver cancer cells, its construction method and application. Background technique [0002] Hepatitis B virus is the most important infectious disease in my country. According to statistics, there are currently about 150 million hepatitis B virus carriers, accounting for more than 10% of the total population of the country. The existence of a large number of clinical and subclinical hepatitis B patients has not only seriously damaged the health of the people, but also caused a huge loss of social labor force and increased social health costs. At the same time, many data confirm that hepatitis B virus is also one of the main causes of primary hepatocellular carcinoma. Hepatocellular carcinoma is one of the malignant tumors with the worst prognosis. There i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/86A61K48/00A61P31/20A61P35/00A61P1/16
Inventor 李川源黄倩吴沛宏黄亚森
Owner 吴沛宏
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products