Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Hydrogen-producing engineering bacteria and application thereof

A technology of engineering bacteria and fragments, applied in bacteria, fungi, introducing foreign genetic material using vectors, etc., can solve the problem of no reports on genes, and achieve the effect of improving hydrogen production capacity and strong substrate utilization capacity.

Inactive Publication Date: 2009-12-23
TSINGHUA UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many reports about the hydrogen production of Enterobacter aerogenes, but most of them are in terms of technology and cultivation [E.Palazzi, B.Fabiano, P.Perego.Bioprocess Eng.22:205-213 (2000).]. Hydrogen-related genes have not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hydrogen-producing engineering bacteria and application thereof
  • Hydrogen-producing engineering bacteria and application thereof
  • Hydrogen-producing engineering bacteria and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1, the acquisition of Enterobacter aerogenes E.aerogenes IAM1183-A

[0046] The starting strain Enterobacter aerogenes (E. aerogenes IAM1183) was purchased from the strain bank of the Institute of Applied Microbiology (IAM), University of Tokyo, Japan.

[0047] Sequence analysis was performed on the Enterobacter aerogenes gene sequence (Genbank NO: EF601125) in NCBI, and a pair of primers hycA-Km-fw and hycA-Km-rv were designed. The sequences of hycA-Km-fw and hycA-Km-rv are as follows :

[0048] hycA-Km-fw:

[0049] 5'- CTGCAATTCGCTGGTTCAGGGCATCACCCTGTCAAAAGCG ATAGGCTCCGCCCCCCTGA-3';

[0050] hycA-Km-rv:

[0051] 5'- GGCTTAAATCCACCGGCTGGTCGTGTTCCATGGCGTCATA CAGGTGGCACTTTTCGGGG-3'.

[0052] The underlined sequences in the primers are the homology arms of E. aerogenes IAM1183 ΔhycA.

[0053] Transformation of pYM-red plasmid (Yu Mei, Zhou Jianguang, Chen Wei, Li Shanhu, Huang Cuifen, establishment of a transferable recombinant engineering system pYM-Red....

Embodiment 2

[0059] Embodiment 2, the growth characteristics of engineering bacteria and the determination of hydrogen production performance

[0060] In a 70mL serum bottle, 20mL of glucose medium was placed, and the activated engineering bacteria E.aerogenesIAM1183-A was cultured in a shake flask; at the same time, the activated wild bacteria were cultured in a shake flask under the same conditions as a control. The specific operation steps are as follows:

[0061] (1) Seed culture: use a 15ml centrifuge tube with 5ml of LB medium, inoculate from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.

[0062] (2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v / v), the culture temperature is 37° C., and the rotation speed o...

Embodiment 3

[0069] Embodiment 3, the metabolic flow analysis of engineering bacteria

[0070] In order to determine the changes brought about by the knockout of the hycA gene on the strain, the distribution of each metabolic flux in the cells of wild bacteria and engineered bacteria was detected respectively. The specific steps are as follows:

[0071] (1) Seed cultivation: use a 15ml centrifuge tube with 5ml of LB medium, inoculate bacteria from a solid plate, cultivate overnight at a temperature of 37°C and an air bath shaker at a speed of 170rpm.

[0072] (2) Anaerobic shake flask culture: adopt 70ml serum bottle anaerobic culture bottle, glucose medium filling capacity 20ml (use the air in the top of culture bottle and culture medium in advance with nitrogen replacement); The inoculation amount of seed bacteria 2.5% (v / v), the culture temperature is 37° C., and the rotation speed of the air bath shaker is 170 rpm. Incubate for 16 hours.

[0073] (3) Metabolites were detected after ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses hydrogen-producing engineering bacteria and application thereof. The hydrogen-producing engineering bacteria are engineering bacteria obtained by inactivating delta hycA protein in E.aerogenes IAM1183, wherein the amino acid sequence of the delta hycA protein is sequence 1 in a sequence list. The hydrogen-producing engineering bacteria can be applied to biological hydrogen production and are of great directive significance to hydrogen production by means of enterobacter aerogenes. Moreover, the hydrogen-producing engineering bacteria have the advantages of strong environmental adaptability, wide substrate utilization range, strong substrate utilization capability and high hydrogen-producing efficiency.

Description

technical field [0001] The invention relates to a hydrogen-producing engineering bacterium and its application. Background technique [0002] The fossil energy system established since the world industrial revolution in the 18th century is now facing two major challenges: 1) The reserves of fossil energy are decreasing day by day, facing the danger of depletion; 2) The combustion of fossil fuels produces a large amount of pollutants, especially CO 2 The greenhouse effect caused by the emission of greenhouse gases has brought a huge threat to the environment on which human beings depend. Therefore, developing sustainable renewable clean energy and gradually replacing fossil energy is an important strategic issue related to national energy security, environmental security and social stability and peaceful development. [0003] Hydrogen energy, as one of the potential alternative clean energy sources in the future, is an efficient energy carrier with the characteristics of hig...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/11C12N15/63C12N5/10C12N1/15C12N1/19C12R1/01
Inventor 邢新会赵洪新马堃卢元王立言张翀
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com