Method and special kit for detecting gene multi-mutant site
A technology of mutation sites and kits, which is applied in biochemical equipment and methods, and the determination/inspection of microorganisms, to achieve the effects of simple instrument requirements, avoiding pollution, and increasing specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1, Detection of Multiple Mutation Sites in Human Mitochondrial 12S rRNA Gene
[0032] 1. Primer design:
[0033] Primer 5.0 software was used to design primers for the 1555 and 1494 mutation sites, the mutation sites were located at the 3′ end of the primers, and the two shared a downstream primer. The Tm value of the amplified product of 1555 was designed to be 77.1°C, and the Tm value of the amplified product of 1494 was 80.1°C.
[0034] In order to enhance the specificity of the reaction, artificially mutated bases were introduced into the penultimate base of the 3' end of primers 1555 and 1494. The primer sequences are as follows:
[0035] Primer at position 1555: 5' CCCTACGCATTTATATAGAGGCGG 3' (SEQ ID NO: 1)
[0036] Primer at position 1494: 5'CACACCGCCCGTCTCT 3' (SEQ ID NO: 2)
[0037] Common downstream primer: 5' GCACTTTCCAGTACACTTACCA 3' (SEQ ID NO: 3)
[0038] For a conserved nucleic acid segment on the mitochondria, internal standard primers were ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com