Porcine circovirus 2 LAMP detection kit and detecting method
A detection kit, porcine circovirus technology, applied in the field of disease diagnosis, can solve problems such as unseen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] 1) Primer design According to the PCV2 strain sequence published by GenBank as a template, the following two pairs of primers were designed, the primer sequences:
[0085] PB1: ATCACAAGGACAACGGAGTG
[0086] PB2: GCCCCACAATGACGTGTAC
[0087] PB3: GCTCTGCAACGGTCACCAGAACCTCTACTGCTGTGAGT
[0088] PB4: TTGTCAGAAATTTCCGCGGGCTTTCGTCTTCCAATCACGCTT
Embodiment 2
[0090] Preparation of the components in the kit: Prepare various components (50 reaction volumes) according to the formula of the following components, and distribute them into small glass or plastic containers and seal them with corresponding stoppers:
[0091] 1. Viral DNA extraction (LBBI-DNA) reagent:
[0092] 1) DA: Dissolve 10ml of 1% 2-mercaptoethanol solution, 3ml of 10mmol / mL Tris-HCL (pH 8.0), 1ml of 10mmol / ml EDTA in sterilized double distilled water, set to 30ml, and put it into a nuclease-free plastic container .
[0093] 2) DB: 200mmol / ml 15ml NaOH and 15ml 1% SDS solution were mixed, fixedly dissolved in deionized water to 30ml, and put into a nuclease-free plastic container.
[0094]3) DC: 75ml absolute ethanol, pH 4.8 200mmol sodium acetate 1ml mixed and put into a plastic container.
[0095] 4) DD: Dissolve 50u of RNAseA in 100ml of nuclease-free water (DEPC), and put it into a nuclease-free plastic container.
[0096] 2. Preparation of the solution in the...
Embodiment 3
[0103] Use of PCV2LAMP Kit
[0104] 1. Extraction of sample DNA
[0105] Add 500μl DA to 100μl tested sample, vortex for 15s, centrifuge at 12000g for 1min, take the supernatant and put it in a new tube; add 300μl DB solution to the supernatant, vortex or vigorously shake for 90s; add an equal volume of DC solution , vortexed for 1 min, then centrifuged at 12000 g for 1 min, discarded the supernatant, left at room temperature for 5 min to dry the precipitate, added 10 μl DD and dissolved it into sample DNA.
[0106] 2. Preparation of reaction solution
[0107] Take 1.5 μl of PB, 12.5 μl of RB and 1.0 μl of EB, put them in a small reaction tube, add 5.5 μl of sample DNA, and mix well.
[0108] 3. The progress of the reaction
[0109] When the temperature of the LAMP Tubidimeter reached 65°C, the reaction tubes into which each component was added were placed in a constant temperature water bath at 65°C for isothermal amplification for 30 minutes.
[0110] 4. Result judgment ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap