Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anther tapetum and pollen specific efficient promoter as well as application thereof

An anther tapetum and promoter technology, applied in the biological field, can solve the problems of long period of male sterility type, single source of sterility gene, etc.

Inactive Publication Date: 2009-09-16
CHINA AGRI UNIV
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the naturally occurring male sterility types rarely have problems such as long cycle and single source of sterility genes, and there are also certain deficiencies in the cultivation of restorer lines and the selection of offspring.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anther tapetum and pollen specific efficient promoter as well as application thereof
  • Anther tapetum and pollen specific efficient promoter as well as application thereof
  • Anther tapetum and pollen specific efficient promoter as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Cloning of maize anther tapetum and pollen-specific promoter sequence pZm401

[0035] The cDNA clone Zm401 (682bp) (Li et al., 2001), which was isolated from the mature pollen cDNA library of maize and obtained pollen-specific expression (Li et al., 2001), was used as a probe (its nucleotide sequence is shown in SEQ ID No.2) to screen the maize genome Library (Cat. #FL1032D, Lot #5443, Clontech, Palo Alto, CA, USA), a genomic clone pGZM401 of the Zm401 gene was obtained. Sequence analysis The total length of the genomic DNA is 6.0kb, of which the 5' end 1-2000 (base position at the beginning of the sequence is 1) is the deduced promoter segment, which has the cis-acting element TATAbox bound by RNA polymerase II (1844-1849) and CAAT box (1720-1723), in addition to the pollen-specific cis-element GC box (1496-1500), the 6bp Q factor (NTP303Qelement, AAATGA, No.801- 806 and LAT52 Q element, TGGTTA, No. 1266-1271) ( figure 1 ).

Embodiment 2

[0036] Example 2. Isolation of maize anther tapetum and pollen-specific promoter sequence pZm401

[0037] The following two primers were designed and synthesized, and a restriction endonuclease HindIII site and a restriction endonuclease XbaI site were respectively added to the 5' ends of the two primers for the needs of separation and construction in the future:

[0038] Primer 1: 5'CC AAGCTT CTGCAGACATAGCTCTCGAC3'

[0039] Primer 2: 5'CATCAAACACTTGGCCTATTACTAGCC3'

[0040] Using the plasmid DNA pGZM401 as a template, carry out PCR reaction, the reaction system is as follows:

[0041] Reaction component Addition amount

[0042] Buffer (10X) (containing 20mmol / LMgCl 2 ) 2.5 μl

[0043] dNTP (10mmol / L) 0.5μl

[0044] Primer 1 (10μmol / L) 0.5μl

[0045] Primer 2 (10μmol / L) 0.5μl

[0046] Taq (2.5u / μl) 0.5μl

[0047] h 2 O 19.5 μl

[0048] Template plasmid (0.2μg / μl) 0.5μl

[0049] Total volume 25.0μl

[0050] Amplification conditions: 95°C for 10 min; 95°C for 1 min...

Embodiment 3

[0051] Example 3. Construction of plant expression vector pZm401::GUS

[0052] as attached figure 2 As shown, the p401pro3Z plasmid was extracted by alkaline lysis, digested with SalI, filled in with Klenow, and then digested with XbaI to obtain the pZm401 promoter fragment, which was expressed in plants that had been digested with HindIII, filled in with Klenow, and digested with XbaI. The large fragments of the vector pBI121 (ClonTech) were ligated, and then the ligated product was transformed into 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( The LB liquid culture medium of final concentration 100 μ g / ml) is cultivated overnight, and centrifugation collects thalline and extracts plasmid by alkaline lysis method, is identified correctly through restriction endonuclease digestion and PCR ( imag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pollen and anther tapetum specific efficient promoter, the nucleotide sequence of which is shown as the sequence table SEQ ID No.1. The promoter sequence is cloned from a maize genome by screening in a maize genome library and can propel a target gene to have specific expression in the anther tapetum and the pollen. The invention comprises a plant gene engineering method for creating male sterileness by using the promoter sequence, namely, the promoter downstream is joined with a heterologous gene or a homologous gene, and a plant expression vector is constructed, a host plant is transformed, the promoter sequence can propel the downstream genes thereof to express the target protein in the anther tapetum and the pollen in a efficient and specific way to realize creating plant male sterileness or modifying the safety of transgenic plants.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an anther tapetum and pollen-specific high-efficiency promoter sequence isolated from maize and its application. The above-mentioned anther tapetum and pollen-specific promoters were cloned from maize genomic DNA, and connected with different homologous and heterologous genes to construct plant expression vectors, and transform host plants, so that transgenic plants can efficiently and specifically express their downstream genes methods and applications. Background technique [0002] In the process of research and development of transgenic plants, it is found that the time, space and expression amount of exogenous gene expression are often important factors that make it impossible to obtain ideal transgenic plants and effectively study the mechanism of gene action. The regulation of transcription level is the most important regulatory mode of plant gene expression regulation. The d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/82C12N5/10A01H5/00C12N15/113
Inventor 于静娟敖光明赵倩刘俊起李成霞王冬雪
Owner CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More