Bt protein Cry56Aal as well as encoding gene thereof and application thereof
A technology of bt protein and gene, applied in application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Cloning of cry56Aa1 gene
[0028] The present invention is isolated from the new bacterial strain of Bacillus thuringiensis (Bacillus thuringiensis) obtained from the plain soil of Chengdu, Sichuan Province. No. 3, Datun Road, Institute of Microbiology, Chinese Academy of Sciences, Zip code 100101) is preserved, and the classification is named Bacillus thuringiensis (Bacillus thuringiensis), and the preservation number is CGMCCNo.2860.
[0029] In this example, the full-length sequence of the Cry56Aa1 gene was cloned by the following method.
[0030] The total DNA of strain YWC2-8 was extracted using a genomic DNA purification kit (purchased from Saibaisheng Company). The primer sequences were designed as follows:
[0031] P1: 5'ATGAATTCATATCAAAATAAAAAATGA 3'
[0032] P2: 5' CTAGAGATTATTGGTAAACAAATCGT 3'
[0033]PCR reaction system:
[0034] 10×buffer 2.5μl
[0035] MgCl 2 (25mM) 1.5μl
[0036] Taq enzyme 0.2μl
[0037] dNTPs (2.5mM) 2μl
[0038] Pri...
Embodiment 2
[0042] Example 2 Expression of cry56Aa gene and determination of insecticidal activity
[0043] According to the sequence at both ends of the open reading frame of the cry56Aa gene, a pair of specific primers cry56A: 5′-GCG was designed and synthesized CATATG (NdeI)ATGAGTATGAAATCATTGATTC-3'; cry56R: 5'-CG GAATTC (EcoR I) CACGTCAGGGGTAAATTCGATT-3', respectively at the 5' end primers Nde I and EcoR I restriction sites. The YWC2-8 plasmid was used as a template for amplification, and the amplified product was double-digested with Nde I and EcoR I, and the digested product was ligated with the vector pET-30a(+) after the same double-digestion, and transformed into E.coli After DH5α competent cells were extracted and its plasmid was digested and electrophoresis verified that the size of the inserted fragment met the expected purpose ( figure 2 ), and then transferred into the recipient strain E.coli.BL21(DE3). The recombinant plasmid was named pET-56Aa, and the recombinant co...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com