Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method

A technology of Cryptosporidium parvum and detection kit, which is applied in the direction of microbial determination/inspection, biochemical equipment and methods, and resistance to vector-borne diseases. It can solve the problems of low specificity and sensitivity, time-consuming and labor-intensive detection rate, To achieve the effect of strong specificity, accurate and objective result judgment, and simple operation

Inactive Publication Date: 2009-01-28
JILIN UNIV
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pathological diagnosis is mostly made through stool microscopy and improved acid-fast staining, which is time-consuming and laborious and has a low detection rate
Immunological diagnosis includes indirect hemagglutination assay (IHA), immunofluorescence assay (IFA), enzyme-linked immunosorbent assay (ELISA), monoclonal antibody (McAb) and other methods, but the specificity and sensitivity of these immunological methods are also low.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method
  • Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method
  • Cryptosporidium and cryptosporidium parvum specific PCR detecting reagent kit and detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Cryptosporidium-specific diagnostic sequence: the conserved part of the sequence of the 18SrRNA gene (this gene is shared by all species of Cryptosporidium and has the smallest gene variation among species), compared to multiple Cryptosporidium in NCBI The species are shared, and the homology is greater than 98%, meeting the genus-specific detection criteria.

[0056] attggaggttgttccttactccttcagcacccttatgagaaatcaaagtctttgggttctagggggagtat

[0057] ggtcgcaaggctgaaacttaaaggaattgacggaagggcaccaccaggagtggagcctgcggcttaatttg

[0058] actcaacacgggaaaactcaccaggtccagacataggaaggattgacagattgatagctccttcttgatt

[0059] ctatggggcggct

[0060] Species-specific diagnostic sequence of Cryptosporidium parvum: a finger-shaped U1 nuclear small molecule ribonucleoprotein gene, which is only shared by human and Cryptosporidium parvum in NCBI comparison, with 100% homology, in line with species-specific detection research standard.

[0061] taagaagccaccaagaaggcggaaggcacaactataatttaagaaagtt...

Embodiment 2

[0068] Specific diagnostic primers were designed according to the Cryptosporidium genus-specific and species-specific diagnostic sequences of Example 1 as follows:

[0069] Genus-specific diagnostic primer: CF: 5'-ATTGGAGGTTGTTCCTTACTCCT-3'

[0070] CR: 5'-AGCCGCCCATAGAATCAAGAA-3'

[0071] Species specific diagnostic primer: HF: 5'-TAAGAAGCCACCAAGAAGGCG-3'

[0072] HR: 5'-TCAATAGGCTTAAATGGGTTCGGGA-3

[0073] The above two primers can simultaneously amplify species-specific and genus-specific diagnostic gene fragments in the same system (duplex PCR), with bright target bands and no non-specific bands. The purpose of simultaneously detecting Cryptosporidium and Cryptosporidium is realized.

Embodiment 3

[0075] Cryptosporidium and Cryptosporidium parvum PCR detection kit, the composition and structure are as follows:

[0076] (1) DNA lysis solution: a mixed solution containing different concentrations of NaCl, Tris-HCl, EDTA, SDS and proteinase K. The ratio of each concentration is: NaCl 100 mM, Tris-HCl (pH 7.5) 20 Mm, EDTA 25 Mm, SDS 2% (w / v) and proteinase K 0.1 μg / μl. The role of the lysate is to lyse the oocyst and digest the proteins within, releasing the genomic DNA.

[0077] (2) PCR reaction solution: 4 kinds of dNTPs with a final concentration of 100-300 μM each, primers CF, CR, HF and HR with a final concentration of 10-100 pmol / μl, and Mg with a final concentration of 1.5-4.5 mM 2+ concentration. Add 2.0 U of Taq enzyme to each PCR reaction (20 μl), and the reaction solution does not contain Taq enzyme.

[0078] (3) Cryptosporidium and Cryptosporidium parvum species-specific primers

[0079] (4) Positive control: the positive control used in the kit of the prese...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a peculiar PCR detection kit of Cryptosporidium and micro Cryptosporidium, comprising a DNA lysis solution, a PCR reaction solution, a peculiar primer of the Cryptosporidium and the micro Cryptosporidium and positive control genomic DNA of the micro Cryptosporidium. According to the diagnosing sequence for analyzing Cryptosporidium and species peculiarities, a Cryptosporidium and species peculiar primer are designed by utilizing a peculiar detection method of PCR, the sensibility of the primer is improved by optimizing and amplifying conditions, the amplifying result can be directly observed by electrophoretic analysis. The kit of the invention has strict design, simple and easy operation, high sensibility and strong peculiarity, can simultaneously identify the Cryptosporidium infection of Cryptosporidium and species peculiarities so as to obtain an accurate and objective judgment result.

Description

technical field [0001] The invention relates to the diagnosis and detection technology of cryptosporidiosis, more precisely, it provides a Cryptosporidium-specific and Cryptosporidium parvum species-specific PCR detection kit and detection method, belonging to the technical field of parasite detection. Background technique [0002] Cryptosporidiosis (Cryptosporidiosis) is a serious zoonosis caused by Cryptosporidium, which can cause severe diarrhea in mammals, especially ruminants and humans. At present, there are 27 species of Cryptosporidium that have been named, and there are many kinds of Cryptosporidium that can infect humans. Among them, the infection of Cryptosporidium parvum is the most common. Cryptosporidium parvum has a wide range of hosts and serious harm. Animals, so it is the most harmful Cryptosporidium species in the Cryptosporidium genus. [0003] The diagnostic methods of cryptosporidiosis mainly include etiological diagnosis, immunological diagnosis and m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/04C12Q1/68
CPCY02A50/30
Inventor 张西臣李建华李巍宫鹏涛张国才杨举李淑红
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com