Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Diagnosis use for chronic medullary system leukemia IFN-alpha-resistant marker gene

A myeloid leukemia and marker gene technology, which is applied in the field of diagnosis of chronic myeloid leukemia resistance IFN-α marker gene, and can solve the problem of inability to detect interferon resistance and the like

Inactive Publication Date: 2008-01-09
CENT SOUTH UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the shortcoming that conventional leukemia diagnostic techniques cannot detect its interferon resistance, first identify the correlation between GSTP1 gene expression and interferon resistance of chronic myeloid leukemia at the mRNA level and protein level, and provide a chronic myeloid leukemia Diagnosis of Myeloid Leukemia Resistance IFN-α Marker Gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnosis use for chronic medullary system leukemia IFN-alpha-resistant marker gene
  • Diagnosis use for chronic medullary system leukemia IFN-alpha-resistant marker gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: RT-PCR is used to verify the expression difference of GSTP1 gene in KT-1 / A3 and KT-1 / A3R cells

[0024] Human chronic myeloid leukemia cell lines KT-1 / A3 and KT-1 / A3R were donated by Professor Ikuya Sakai of Ehime University, Japan.

[0025] 1. Primer design

[0026] The cDNA sequences of the GSTP1 gene (accession number: NM_000852) and the internal reference β-actin gene (accession number: NM_001101) were found in GeneBank, and the amplification primers were designed with Primer 5 software. The sequences are as follows:

[0027] GSTP1-F: 5'GCCCTACACCGTGGTCTATT 3'

[0028] GSTP1-R: 5′ GACGCAGGATGGTATTGGA 3′

[0029] β-actin-F: 5′GTGGACATCCGCAAAGAC 3′

[0030] β-actin-R: 5′AAAGGGTGTAACGCAACTAA 3′

[0031] The primers were synthesized by Shanghai Sangon Company, and the sizes of the amplified products were 302 bp (β-actin) and 209 bp (GSTP1), respectively, and the products all spanned more than one intron in the genomic DNA sequence.

[0032] 2. Cell cultu...

Embodiment 2

[0060] Example 2: Using Western blotting to verify the difference in the expression of GST pi protein in KT-1 / A3 and KT-1 / A3R cells

[0061] 1. Cell preparation: make the density 2×10 5 cells / ml of KT-1 / A3, KT-1 / A3R cells in 2 flasks each, placed at 37°C, 5% CO 2 Cultured in the incubator for 48hr.

[0062] 2. Preparation of protein samples

[0063] 1) Pour the culture solution into a 15ml centrifuge tube and centrifuge at 2500g for 5min.

[0064] 2) Discard the supernatant, add 5ml of PBS, shake gently and centrifuge at 2500g for 5min, discard the supernatant, wash and centrifuge once with PBS repeatedly.

[0065] 3) Add 400 μl RIPA lysate (50mM Tris-HCl, pH7.4; 150mM NaCl; 1mM EDTA; 1% Triton X-100; 1% sodium deoxycholate; 0.1% SDS) to suspend the cell pellet and transfer to a 1.5ml centrifuge tube , the protease inhibitor PMSF (100 mM stock solution prepared with isoamyl alcohol, stored at -20°C) was added to a final concentration of 1 mM, and lysed in an ice bath for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An invention relates to use of IFN-alpha resisting marker gene in diagnosis of chronic marrow leukemia. High expression of GSTP1 gene is discovered in cells concerned with tolerant strain KT-1 / A3R of IFN-alpha by RT-PCR analysis while low expression of GSTP1 gene discovered in cells with sensitive strain KT-1 / A3. Also, high expression of GSTP1 discovered about ITN-alpha resisting tolerant strain KT-1 / A3R by Western blotting while low expression of GSTP1 discovered about ITN-alpha sensitive strain KY-1 / A3, so that GSTP1 gene can be used as marker gene in diagnosis of drug resistance.

Description

technical field [0001] The invention relates to the field of interferon drug resistance, in particular to the diagnostic application of chronic myeloid leukemia resistance IFN-α marker gene. Background technique [0002] Chronic myelogenous leukemia (CML), also known as chronic myeloid leukemia, is a relatively common malignant myeloproliferative disease originating from bone marrow pluripotent stem cells. Clinically, CML is characterized by fatigue, emaciation, fever, and splenomegaly. Large and abnormally increased white blood cells are the main manifestations. The incidence of CML varies in different regions of the world. The incidence of CML in my country is on the rise, and the incidence of males is higher than that of females. [0003] The treatment of CML has evolved from traditional antiproliferative chemotherapy to biological therapy, including allogeneic bone marrow transplantation (ALLO-BMT), allogeneic hematopoietic stem cell transplantation (ALLO-HSCT), and in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 陈汉春胡维新
Owner CENT SOUTH UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More