Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for preparing recombinant canine alpha-type interferon

A technology for interferon and recombinant protein, which is applied to the preparation method of peptide, interferon, and botanical equipment and method, etc., can solve the problems of high technical conditions of canine leukocyte interferon, difficulty in obtaining wide application and high cost. , to achieve no toxic side effects, no environmental pollution, good curative effect

Active Publication Date: 2008-01-09
ANHUI JIUCHUAN BIOTECH +1
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Existing data show that: at present, domestic and foreign production of canine leukocyte interferon requires relatively high technical conditions, and the cost of forming the product is high and expensive, which is not suitable for my country's national conditions
Therefore, it is difficult to be widely used
However, the production of recombinant canine α-interferon by genetic engineering technology has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] Preparation process of recombinant canine α-type interferon:

[0033] 1. Construct the cloning vector:

[0034]犬α型IFN的目的基因为: atggccctgc cctgctcctt ctcggtggcc ctggtgctgctcagctgcca ctccctgtgc tgtctggctt gcgacctgcc cgacacccac agcctgcgca actggagggtcctgacgctc ctgggacaga tgaggagact ctccgccagc tcttgtgacc actacaccac tgactttgccttccccaagg aactgtttga tggccagcgg ctccaggagg cgcaagccct ctctgtggtc cacgtgatgacccagaaggt cttccacctc ttctgcacga acatgtcctc tgctccttgg aacatgaccc tcctgggggaattgtgctcg gggctctctg agcagctgga tgacctggat gcctgtcccc tgcaggaggc agggctggccgagacccccc tcatgcatga agactccacc ctgaggacct acttccaaag gatctccctc tacctgcaagacaggaacca cagcccgtgt gcctgggaga tggtccgagc agaaatcggg agatccttct tctccttgaccatcttgcaa gaaagagtaa ggaggaggaa atga

[0035] Specific primers: upstream: AAT TTG CCA CCT GCC CGA CA

[0036] Downstream: GAT CTT TCC TCC TCC TGA TTC TTT C

[0037] After amplifying the target gene of canine α-interferon by PCR with specific primers, clone the target g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Production of recombinant alpha-canine interferon is carried out by augmenting alpha-interferon target gene of specific primer PCR, connecting with expression carrier PET-28a, converting colibacillus, expressing canine-alpha interferon efficiently, high-purifying, killing bacterium, split charging and freeze drying. It's simple, safe, reliable and non-toxic. It's convenient to transport and store. It can be used to treat canine parvoviral and virus diarrhea etc. diseases as broad-spectrum antiviral preparation.

Description

technical field [0001] The invention relates to a recombinant canine alpha interferon, which is a preparation method of the recombinant canine alpha interferon for treating viral diseases such as canine viral diarrhea and influenza. Background technique [0002] Canine viral diseases are currently the main infectious diseases that seriously restrict the healthy development of the dog breeding industry. Happens throughout the year, such as canine parvovirus, acute viral gastroenteritis, etc. Once these animals are infected, they have the characteristics of acute onset, severe clinical symptoms, easy spread, and high mortality and mortality, which cause huge economic losses to the breeding industry; more importantly, pet dogs and In close contact with humans, some zoonotic diseases also pose potential threats to human health. However, traditional treatment plans are sometimes difficult to work clinically, especially for viral diseases, which may cause new infectious diseases...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/21C07K1/14C07K14/56A61K38/21A61K9/19A61P31/12
Inventor 王明丽
Owner ANHUI JIUCHUAN BIOTECH
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More