ELISA kit for detecting EPSPS gene in herbicide-tolerance soybeans and method of use thereof
An enzyme-linked immunosorbent reagent, CP4-EPSPS technology, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of inability to achieve quantitative detection, limitations in popularization and application, and cumbersome operation process, and achieves simple structure, low price, and portability. convenient effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Embodiment 1 The establishment process of the detection kit of the present invention
[0025] 1. Antigen preparation:
[0026] (1) Cloning of CP4-EPSPS gene from transgenic soybean
[0027] According to the published sequence of the CP4-EPSPS gene in transgenic soybean, primers were designed from both ends of the open reading frame of the gene, and HindIII and SalI restriction sites were added respectively. The designed primer sequences were:
[0028] Primer F: 5'TTTGTCGACATGTCGCACGGTGCAAGGAGC 3'
[0029] Primer R: 5'AAAGCTTCAGGCAGCCTTCGTATGGGAG 3'
[0030] Total DNA was extracted from leaves of transgenic soybean seedlings according to the CTAB method, and used as a template to perform PCR amplification using the above primers to clone the CP4-EPSPS gene. The PCR reaction parameters are: pre-denaturation at 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 sec—62°C for 30 sec—72°C for 1.5 min, and finally 72°C for 10 min. The PCR product was connected to the...
Embodiment 2
[0061] Example 2 Precision, Accuracy and Shelf Life Experiment of Transgenic Soybean ELISA Kit
[0062] 1. Precision experiment
[0063] Get transgenic soybeans and non-transgenic soybeans mixed into three concentrations (w / w) of 10%, 5%, and 2.5%, respectively take three different batches of kits prepared in Example 1, and repeat each concentration for 5 times to calculate the coefficient of variation. The results are as follows, the intra-assay coefficient of variation is 5.12%, and the inter-assay coefficient of variation is 10.3%.
[0064] 2. Accuracy experiment
[0065] Three concentrations of EPSPS protein standards (50ug / L, 100ug / L, 200ug / L) were taken and added to non-transgenic soybean samples for addition and recovery experiments. Each concentration was repeated 5 times to calculate the accuracy respectively. The results showed that the recovery rate of the kit ranged from 80.7% to 110.2%.
[0066] 3. Storage period experiment
[0067] The kit was placed under t...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com