Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ELISA kit for detecting EPSPS gene in herbicide-tolerance soybeans and method of use thereof

An enzyme-linked immunosorbent reagent, CP4-EPSPS technology, which is applied in measurement devices, instruments, scientific instruments, etc., can solve the problems of inability to achieve quantitative detection, limitations in popularization and application, and cumbersome operation process, and achieves simple structure, low price, and portability. convenient effect

Inactive Publication Date: 2007-09-26
SOUTH CHINA AGRI UNIV
View PDF0 Cites 29 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The operation process is too cumbersome and the detection time is too long, so it cannot be applied in actual work at all
In addition, the transgenic soybean ELISA detection kit (Agdia, USA) that has been commercialized abroad cannot achieve quantitative detection and is expensive, which limits its popularization and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA kit for detecting EPSPS gene in herbicide-tolerance soybeans and method of use thereof
  • ELISA kit for detecting EPSPS gene in herbicide-tolerance soybeans and method of use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 The establishment process of the detection kit of the present invention

[0025] 1. Antigen preparation:

[0026] (1) Cloning of CP4-EPSPS gene from transgenic soybean

[0027] According to the published sequence of the CP4-EPSPS gene in transgenic soybean, primers were designed from both ends of the open reading frame of the gene, and HindIII and SalI restriction sites were added respectively. The designed primer sequences were:

[0028] Primer F: 5'TTTGTCGACATGTCGCACGGTGCAAGGAGC 3'

[0029] Primer R: 5'AAAGCTTCAGGCAGCCTTCGTATGGGAG 3'

[0030] Total DNA was extracted from leaves of transgenic soybean seedlings according to the CTAB method, and used as a template to perform PCR amplification using the above primers to clone the CP4-EPSPS gene. The PCR reaction parameters are: pre-denaturation at 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 sec—62°C for 30 sec—72°C for 1.5 min, and finally 72°C for 10 min. The PCR product was connected to the...

Embodiment 2

[0061] Example 2 Precision, Accuracy and Shelf Life Experiment of Transgenic Soybean ELISA Kit

[0062] 1. Precision experiment

[0063] Get transgenic soybeans and non-transgenic soybeans mixed into three concentrations (w / w) of 10%, 5%, and 2.5%, respectively take three different batches of kits prepared in Example 1, and repeat each concentration for 5 times to calculate the coefficient of variation. The results are as follows, the intra-assay coefficient of variation is 5.12%, and the inter-assay coefficient of variation is 10.3%.

[0064] 2. Accuracy experiment

[0065] Three concentrations of EPSPS protein standards (50ug / L, 100ug / L, 200ug / L) were taken and added to non-transgenic soybean samples for addition and recovery experiments. Each concentration was repeated 5 times to calculate the accuracy respectively. The results showed that the recovery rate of the kit ranged from 80.7% to 110.2%.

[0066] 3. Storage period experiment

[0067] The kit was placed under t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses one EPSPS gene enzyme immune agent case and its use method in the anti-herbicide bean, wherein, the case comprises anti-EPSPS multi-clone antigen, enzyme board with the antigen, enzyme antigens for two, gene switch bean standard product, non-transfer gene bean standard, intense wash liquid, develop liquid and terminal liquid. This invention method comprises the following steps: cloning CP4-EPSPS gene from the gene switch bean expressed in the bacillus coli; then through protein purification complex property to regroup EPSPS protein antibody immune animal to get special single clone antigen and multi-clone antigen; establishing double antigen clamp enzyme immune system test sample to determine its EPSPS protein content.

Description

technical field [0001] The invention relates to the field of ELISA kits, in particular to an ELISA kit for detecting EPSPS genes in herbicide-resistant soybeans and a method for using the same. Background technique [0002] According to the report of the International Service for the Application of Agricultural Biotechnology (ISAAA), in 2006 the planting area of ​​GM crops in the world reached 102 million hectares. Among the transgenic crops that have been commercially produced, transgenic herbicide-tolerant soybean has the largest planting area. This soybean is due to the transfer of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, the enzyme encoded by the gene is the target enzyme of the herbicide glyphosate, So that this genetically modified soybean can grow normally in the environment of the herbicide glyphosate. [0003] With the commercialization of genetically modified crops, many countries (including my country) have strengthened their safety assessment a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/543
Inventor 梅曼彤许少鹏赵均良姚涓穆虹周峰姜大刚
Owner SOUTH CHINA AGRI UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More