Recombined expression of peptide for lowering blood sugar in long acting, and application in medication for treating diabetes
A therapeutic drug and hypoglycemic technology, applied in the direction of medical preparations containing active ingredients, drug combinations, recombinant DNA technology, etc., can solve the problems of limited clinical application and short half-life
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0039] The recombinant expression of the long-acting hypoglycemic peptide and its application in diabetes treatment drugs will be further described below in conjunction with the examples:
[0040] Expression of GLPAG-human albumin fusion protein in Pichia pastoris:
[0041] Acquisition of the GLPAG gene:
[0042] First synthesize the following primers (synthesized by Dalian Bao Biological Engineering Co., Ltd.):
[0043] GLP-F1: 5' tactcgagaaaagacatggtgaagggacctttaccagtg 3';
[0044] GLP-R1: 5'tccaaataagaacttacatcactggtaaaggtccc 3';
[0045] GLP-R2: 5' tccttggcagcttggccttccaaataagaacttac 3';
[0046] GLP-R3: 5'accagccaagcaatgaactccttggcagcttggcc 3';
[0047] GLP-R4: 5' tcggcctttcaccagccaagcaatg 3';
[0048] They were spliced into a complete GLPAG gene by fusion PCR, and the spliced sequence is as follows: 5'tactcgagaaaagacatggtgaagggacctttaccagtgatgtaagttcttatttggaaggccaagctgccaaggagttcattgcttggctggtgaaaggccga 3'; the 5' end of the sequence has xho I restriction endon...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com