Method for improving stress resistance of plant
A plant stress resistance and stress resistance technology, which is applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc. Enhancement, stress resistance enhancement, strong antioxidant effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1, the acquisition of transgenic SeNHX1 and / or BADH plants and their functional verification
[0039] The trade name of the antibiotic Timentin is "Timentin" (ticarcillin sodium-clavulanate potassium for injection), manufacturer: SmithKline Beecham Pharmaceuticals, UK, and was purchased from the Third Affiliated Hospital of Peking University.
[0040] 1. Construction of recombinant expression vectors for transgenic use
[0041] 1. Construction of a recombinant vector containing the key gene BADH for betaine synthesis of spinach
[0042] The total RNA of spinach was extracted, the total RNA was reverse-transcribed with AMV reverse transcriptase (purchased from Takara Company), and cDNA was obtained as a template, and PCR amplification was performed with primer 15′TTACCAAGCTTATGGCGTTCCCAATTCCT 3′ and primer 25′TTACCGAGCTCTCAAGGAGACTTGTACCA 3′ , the amplification system is 50μl, containing 10mmol / LTri-HCl pH8.3, 50mmol / L KCl, 1.5mmol / L Mg 2Cl, 200μmmol / L of vario...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com