Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving stress resistance of plant

A plant stress resistance and stress resistance technology, which is applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant genetic improvement, etc. Enhancement, stress resistance enhancement, strong antioxidant effect

Inactive Publication Date: 2007-05-30
INST OF BOTANY CHINESE ACAD OF SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the stress resistance obtained by simply introducing a single gene into plants is still far from being satisfactory.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving stress resistance of plant
  • Method for improving stress resistance of plant
  • Method for improving stress resistance of plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1, the acquisition of transgenic SeNHX1 and / or BADH plants and their functional verification

[0039] The trade name of the antibiotic Timentin is "Timentin" (ticarcillin sodium-clavulanate potassium for injection), manufacturer: SmithKline Beecham Pharmaceuticals, UK, and was purchased from the Third Affiliated Hospital of Peking University.

[0040] 1. Construction of recombinant expression vectors for transgenic use

[0041] 1. Construction of a recombinant vector containing the key gene BADH for betaine synthesis of spinach

[0042] The total RNA of spinach was extracted, the total RNA was reverse-transcribed with AMV reverse transcriptase (purchased from Takara Company), and cDNA was obtained as a template, and PCR amplification was performed with primer 15′TTACCAAGCTTATGGCGTTCCCAATTCCT 3′ and primer 25′TTACCGAGCTCTCAAGGAGACTTGTACCA 3′ , the amplification system is 50μl, containing 10mmol / LTri-HCl pH8.3, 50mmol / L KCl, 1.5mmol / L Mg 2Cl, 200μmmol / L of vario...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an improving method of plant inhibiting-proof property, which is characterized by the following: transplanting SeNHX1 gene and BADH gene into plant through plant expressive carrier; sieving to obtain high-inhibiting plant; obtaining gene-transmitting tobacco; improving wild-typed plant production.

Description

technical field [0001] The invention relates to a method for improving stress resistance of plants. Background technique [0002] Soil salinization has affected more than 100 countries in the world and is a bottleneck restricting agricultural development in all semi-arid regions. According to statistics, the saline soil in the world accounts for about 1 / 4 to 1 / 3 of the land area, and about 20% of the arable land in the world is affected by salinization. In my country, there are different types of saline-alkali soils from coastal to inland, from lowland to plateau. Saline-alkali soil is not only an important land resource in other countries in the world, but also in my country. The total area of ​​saline-alkali soil in my country is about 500 million mu, of which more than 100 million mu has been reclaimed, and more than 300 million mu of saline wasteland (accounting for about 80%) is waiting for development and utilization. Due to the impact of climatic conditions and unr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/82
Inventor 李银心周树峰
Owner INST OF BOTANY CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More