Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use

A technology of antibacterial protein and prawn, applied in application, antibacterial drugs, genetic engineering, etc., can solve the problems of mariculture industry loss, mariculture animal disease difficulty, etc., and achieve the effect of ensuring correct formation and far-reaching significance

Inactive Publication Date: 2007-03-28
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the 1990s, large-scale disease outbreaks have caused huge losses to the mariculture industry. The abuse of antibiotics and the deterioration of the environment have made it difficult to fundamentally control the diseases of mariculture animals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0034] A cloned Chinese prawn antibacterial protein gene has the following sequence:

[0035] (1) Information of SEQ ID No 1 (see sequence listing)

[0036] (a) Sequence features:

[0037] * Length: 523 bp

[0038] *Type: nucleic acid

[0039] * Chain type: double chain

[0040] *Topology: Linear

[0041] (b) Molecular type: cDNA

[0042] (c) Assumption: No

[0043] (d) Antisense: no

[0044] (e) Original source: Chinese prawns (Fenneropenaeus chinensis)

[0045] Sequence description: SEQ ID No.1

[0046] GAGTCCGTTCATCGCACAGCCGAGAAACACTATCAAGATGTTGAAGTTTGTAGTATTATCCGTTGTCGCCGTG

[0047] GCTGTGGTACACGCCCAGAATAAAGACGATACTCGCTTCCTTGGCGGAGTTCCTGGGGTTGGGGGTGGCTTCGTT

[0048] CCAGGGGTTCCTGGGCATGGCGGCGTTGCTCCTGTAGGCGGTGGCCTTGTCCCTGGCGGCGGTGGCCTTATCCCT

[0049] GGAGGTGGATTCGAGTGCAATTACTGCAGAACGAGGTACGGATACGTATGCTGCAAGCCCGGCAGGTGTCCACCG

[0050] GTTCGCGACGTCTGCCCAGGCCTCAGGCAGGGTGTCCCGATCTGCCGTCAGGACACCGACTGCTTCGGCTCCGAC

[0051] AAATGCTGCTACGACGTCTGCTTGAACGACACCGTCTGCAAACC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Fenneropenaeus chinensis antimicrobial protein gene and the recombination expression and the application. It has the amino acid sequence of SEQ ID No.2 and basic group sequence of SEQ ID No.1 in sequence table. It selects the carrier of the antimicrobial protein pCR T7 / NT TOPO TA and host bacterium BL21(DE3)pLysS that could high efficiently express recombination protein. Aimed at the feature of plural disulfide bonds, using the oxidation reduction system made of oxidized form of glutathione and glutathione in separating and purification and protein recombination process, the recombination protein with antimicrobial ability would be gained. The protein has strong inhibition to the growth of gram positivebacteria, and some inhibition to gram negativebacteria.

Description

technical field [0001] The invention relates to the expression of an antimicrobial protein (crustin) gene in the field of genetic engineering, in particular to a Chinese prawn antimicrobial protein gene and its recombinant expression and application. Background technique [0002] Shrimp farming is one of the pillar industries of mariculture. With the increasing market demand for high-quality aquatic products, shrimp farming occupies an increasingly important position in aquaculture. Since the 1990s, large-scale disease outbreaks have caused huge losses to the mariculture industry. The abuse of antibiotics and the deterioration of the environment have made it difficult to fundamentally control the diseases of mariculture animals. [0003] Mariculture species live in a water environment rich in various microorganisms, and long-term environmental pressure makes them form effective defense functions. Antimicrobial peptides (proteins) are considered to be one of the main compone...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435C12N15/09C07H21/00A01N63/00
CPCC07K14/43509A61K38/00A61P31/04
Inventor 相建海张继泉李富花王在照
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More