Preparation process of human recombined parathyroid hormone 1 84
A parathyroid hormone, -PTH84 technology, applied in the direction of parathyroid hormone, botany equipment and methods, microbial-based methods, etc., can solve the problems of low yield, difficult to scale up production, etc., to achieve high yield, excellent effect, The effect of omitting the renaturation step
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] Embodiment 1: construction of engineering bacteria
[0058] Target gene synthesis: The target gene design is shown in Sequence 2, with a full length of 289 bp. Obtained by overlapping extension polymerase chain reaction (gene splicing by over lap extension PCR, SOE PCR), first synthesize the following five primer (Primer) fragments:
[0059] Primer1 (5'CTGGGTACCGATGACGATGACAAGTCTGTGAGTGAAATTCAGCTGATGCATAACCTGGGGAAACATCTGAACT3'),
[0060] Primer2(5'AAAATTGTGCACATCCTGCAGCTTCTTACGCAGCCATTCTACACGCTCCATCGAGTTCAGATGTTTCCCCAG3'),
[0061] Primer3(5'TACGCGGACGCTGGGAACCAGCATCGCGCGGAGCCAGCGGGGCACCCAGGGCAACAAAATTGTGCACATCCTGCA3'),
[0062] Primer4(5'TCTGCCTCGCCCAGGCTTTTTTCATGGCTCTCAACCAAGACATTGTCTTCCTTTTTACGCGGACGCTGGGAACCA3'),
[0063] Primer5 (5'CGCAAGCTTATTCACTGGGATTTAGCTTTAGTTAATACATTCACATCGGCTTTGTCTGCCTCGCCCAGGCTTTT3').
[0064] Four rounds of PCR were performed to synthesize the designed sequence. In the first round of PCR, primer 1 and primer 2 were used as sense and a...
Embodiment 2
[0067] Embodiment 2: Engineering bacteria BL21(DE3) / pET32a(+)-PTH84 fermentation
[0068] Fermentation was carried out in NLF-22 fermenter (BIOENGINEERING, Switzerland), 10L medium was inserted into 500ml seed liquid, the culture temperature was controlled at 30°C, pH 7.0, fed with constant dissolved oxygen (30%) for cultivation, OD600 reached 35, and the final IPTG with a concentration of 0.2mmol was induced for 3 hours to terminate the fermentation, and the cells were collected.
Embodiment 3
[0069] Example 3: Purification of rhPTH 1-84
[0070] The bacterium obtained in Example 2 was suspended in the lysate (50mM imidazole, pH7.0, 20mMPhosphate Buffer (PB)), the wall was broken by a high-pressure homogenizer, and centrifuged; the supernatant was passed through a nickel ion chelating column balanced with the lysate Ni 2+ -Chelating Sepharose FF (Amersham Biosciences, Sweden), eluent (200mM imidazole, pH7.0, 20mM PB) was eluted, and the elution peak was collected; the protein concentration was measured, diluted to 5mg / ml, and enterokinase was added to a final concentration of 0.5U / ml, 37°C, 24 hours; pass the enzymatic solution through a DEAE Sepharose FF (Amersham Biosciences) column (pH 7.8, 20mM PB), collect the flow-through; adjust the pH to 6.5, and pass through a SP Sepharose FF (Amersham Biosciences) column (Equilibrated at pH 6.5, 20mM PB), eluted with 400mM NaCl, pH 6.5, 20mM PB, and collected the eluted peak; passed through a Superdex-75 (Amersham Bioscie...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap