Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Blood vessel formation inhibitor IIM3 and its preparation method and application

An angiogenesis inhibition and production method technology, applied to medical preparations containing active ingredients, pharmaceutical formulas, peptide/protein components, etc., can solve problems such as unsatisfactory effects, achieve improved anti-tumor effects, reduce costs, The effect of enhancing the anti-tumor effect

Inactive Publication Date: 2006-09-13
徐寒梅
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The αvβ3 antibody currently being researched and developed includes Vitaxin (LM609), which is clinically used for anti-angiogenic therapy (Gutheil, J.C.et al.2000), but some data report that the effect is not satisfactory (Posey, J.A.et al.2001)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blood vessel formation inhibitor IIM3 and its preparation method and application
  • Blood vessel formation inhibitor IIM3 and its preparation method and application
  • Blood vessel formation inhibitor IIM3 and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] 1. Cloning of HM-3 gene and construction of its prokaryotic expression vector

[0039] Take the endostatin gene as a template (provided by our laboratory); synthesize upstream primers and downstream primers, wherein the upstream primers add NdeI restriction sites; the downstream primers contain Arg-Gly-Asp sequences and XhoI sites. Carry out PCR amplification, amplified products are recovered and purified by agarose gel electrophoresis, digested with NdeI and XhoI, cloned into prokaryotic expression vector pET29a (Novagen), positive clones are screened by PCR, and nucleotide sequence analysis confirms that the sequence has occurred Design mutations.

[0040] Synthetic primer 1: 5′GCCATATGCACAGCCACCGCGACTTCCAGCCGG 3′

[0041] Synthetic Primer 2:

[0042] 5′ GGCTCGAGGCAGAAGCAGTCACCACGGCAGTCGCATGCACCACCACCACC 3′

[0043] Wherein, primer 1 encodes NdeI site and partial sequence of endostatin, and primer 2 encodes XhoI site and a gene containing Arg-Gly-Asp sequence.

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

An efficient angiogenesis depressant HM-3 for treating the solid tumors including stomach cancer, lung cancer and liver cancer is prepared through expressing in colibacillus by genetic engineering method, separating the protein of inclusion body, dissolving, re-naturalizing, and separating-purifying by ion change and chromatography.

Description

[0001] One. technical field: the present invention belongs to bioengineering pharmaceutical technical field. 2. Background technology [0002] Studies have shown that the growth of solid tumors depends on angiogenesis. Angiogenesis can not only provide the nutrients and oxygen needed by the tumor, excrete metabolites, but also serve as a way for distant metastasis. Therefore, blocking neovascularization may be a means to prevent tumor growth and metastasis, thereby motivating extensive research on pro-angiogenic and anti-angiogenic molecules. [0003] According to tumor development, angiogenesis is divided into two phases: prevascular and vascular. In the early vascular stage, the tumor grows steadily, and the growth rate of tumor cells is basically the same as the rate of apoptosis; in the vascular stage, the tumor cell tissue grows rapidly, infiltrates, and spreads tumor cells by blood, and the proliferation rate of tumor cells does not change. And the rate of apoptosis is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/16A61P35/00
Inventor 徐寒梅康志安
Owner 徐寒梅
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com