Eight human miRNAs
A technology of milf-5 and milf-1, applied in the professional field of biomedicine, can solve the problems of little understanding of miRNA biological function and unclear miRNA expression distribution.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0053] Cloning and analysis of miRNA
[0054] 1. Extraction and purification of human fetal liver small RNA
[0055] Using mirVanaTM miRNA Isolation (Ambion, Austin, TX) kit to extract small RNA (≤200nt) from 30 mg fetal liver tissue, dissolve in RNase-free water, and measure RNA concentration at 260 nm.
[0056] 2. Construction of small RNA molecule cDNA library
[0057] First, poly(A) tails were added to the 3′ end of the small molecule RNA using the Poly(A) Tailing Enzyme Kit from Takara Company. Add 1.5 μg small RNA, 5 U poly(A) polymerase (Takara), 5 μl 10× buffer and 1 mmol / L ATP to the 50 μl reaction system, and react at 37°C for 30 minutes. phenol / chloroform extraction, ethanol precipitation to recover RNA. T4RNA ligase (Invitrogen) was used to add a 44nt RNA linker (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) to the 5' end of the RNA, phenol / chloroform extraction, and ethanol precipitation to recover RNA. Then use the 60nt RT anchor primer containing multi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com