Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

G-type lysozyme gene of Chlamys farreri and encoded protein and cloning method thereof

A technology of Chlamys farreri and cloning methods, applied in the fields of botanical equipment and methods, biochemical equipment and methods, genetic engineering, etc.

Inactive Publication Date: 2006-04-26
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report of g-lysozyme in invertebrates. Related marine organisms have reported carp g-lysozyme reported by Savan, white shrimp c-lysozyme reported by Rogerio, zebrafish c-lysozyme reported by Feng Liu, and Hikima reported Flounder g-lysozyme, and shellfish i-lysozyme with homology to cly reported by Olsen, Nilson et al.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1. A cloned Chlamys farreri G-type lysozyme gene has the following sequence:

[0017] (1) Information of SEQ ID NO.1 in the sequence listing

[0018] sequence feature

[0019] Length: 829 bp

[0020] Type: nucleic acid

[0021] Chain type: double chain

[0022] Topology: Linear

[0023] Source: Chlamys farreri

[0024] Sequence description:

[0025] GCACGAGGCTAGATTCCAACGATGAACCCACTGGCAGTACTCACACTTCTTGCTATCAGCACTG

[0026] GTGCCTGGGCAGCGTCCTACACCTGCCATGGTGACGTCACACGACTTCATCCCCATGGACAACA

[0027] CAATAGAGGTGTCGCTGCATCCAACCGTGGCGTAGATTACGATTACCATGACCTGTTAGCCAAG

[0028] AAAAGTTGTTACGAAGCATCAGGCGCACGACACTGTATTCAGCCGTCTGTGATTGCCGCCTTGG

[0029] CCAGTCGAGAATCACGTGGAGGGCGTCTTCTGACGTCCAACAGGAGGATGGGGAGATCATCACCA

[0030] TGCCTACGGTATATTACAGTGTGACATCCGCTACCACTCCTGTCAGCAGTACGCTTGGAACAGT

[0031] TGTGAACACATAGAACAAATGGTGAAGGAGGTCCTTGTGGCATACATCGGTCAGGTGGCGCGTA

[0032] AACATCCCACGTGGTCACGAGATCAGCAACTCCAAGGTGGTATCGCCGCCTACAACTCCGGAGT

[0033] TGGCAACGTCCAGAC...

Embodiment 2

[0050] Example 2. Cloning of Chlamys farreri G-type lysozyme gene

[0051] 1) Extraction of total RNA of Chlamys farreri and purification of mRNA: Collect hemolymph from the adductor muscle of Chlamys farreri infected with Vibrio anguillarum with a syringe, centrifuge at 700g at 4°C for 10 minutes, use Trizol reagent from Invitrogen Company and refer to It shows that total RNA is extracted, and mRNA is purified using Oligotex mRNA Purification Kit from QIAGENE Company.

[0052] 2) Construction of cDNA library of Chlamys farreri: Utilize Stratagene company cDNA Synthesis Kit and ZAP-cDNA Synthesis Kit (Stratagene) and carry out cDNA synthesis with reference to the instructions for use. After phosphorylation and Xho I endonuclease digestion, use the QIAEX II Agarose Gel Extraction Kit from QIAGEN Company to recover the restriction fragments larger than 100bp, connect to the Uni-ZAP XR vector carrier from Invetrogen Company, and use ZAP-cDNA®Gigapack from Stratagene Company III G...

Embodiment 3

[0060] Example 3. Application of the Sequence of Chlamystis G-Type Lysozyme Gene in Genetic Selection of Chlamys farreri

[0061] According to the sequence of SEQ ID NO.1 in the sequence table in Example 1, PCR and RT-PCR primers were designed to amplify and sequence the partial sequences of the different individual G-type lysozyme genes of Chlamys farreri, and compare the different individuals in the G-type lysozyme gene. The differences in the lysozyme gene sequence and the difference in the mRNA expression level of the G-type lysozyme gene in different individuals were compared to guide the genetic selection of Chlamys farreri.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to type G lysozyme, and is especially type G lysozyme gene of Chlamys Farreri and its coded protein and cloning method. The type G lysozyme gene of Chlamys Farreri has the base sequence shown in SEQ ID No. 1, and its coded protein has the amino acid sequence shown in SEQ ID No 2. The type G lysozyme gene of Chlamys Farreri the present invention clones has polyadenyl acid tailing signal and polyadenyl acid tail, has important function in immunologic defence of Chlamys Farreri, and may be used in the recombinant expression and gene transfer of lysozyme. The present invention lays foundation for the disease prevention and treatment, gene aided selective breeding and medicine development of Chlamys Farreri.

Description

technical field [0001] The invention relates to a G-type lysozyme, in particular to a Chlamys farreri G-type lysozyme gene (cDNA full sequence and amino acid sequence) and a cloning method for cloning the Chlamys farreri lysozyme from the Chlamys farreri cDNA. Background technique [0002] Lysozyme was discovered by Fleming in 1922 (Proc.R.Soc.Lond.B.Biol.Sci.1922). The full name of the enzyme is 1,4-β-N-lysozyme, also known as mucopeptide N-acetylmuramoyl hydrolase, which can hydrolyze the β between N-acetylglucosamine and N-acetylmuramic acid in the bacterial cell wall -1,4-glucosidic bond destroys the peptidoglycan scaffold, and the cells swell and crack under the action of internal osmotic pressure, causing bacterial lysis, so it is also called muramidase, that is, N-acetylmuramoside glycan hydrolase . Some Gram-negative bacteria, such as Escherichia coli and Salmonella typhi, are also destroyed by lysozyme. Human and animal cells have no cell wall structure and no pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/36C12N15/10
Inventor 宋林生邹慧斌胥炜相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com