Colibacillus plasmid vector and its application method
A plasmid vector, Escherichia coli technology, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] (1) Design and synthesis of promoters and terminators:
[0040] According to E. coli σ 32 Design a new type of promoter based on the base common sequence of the recognized promoter, whose sequence is 5'- CCCCC TTGAATGTGGGGGAA ACAT CCCC AT GATCCAAGGA G-3' (underlined part is the common sequence), named heat shock promoter (Hshpromoter, figure 1 ); According to the GeneBank file ECORPSRPO, design a GAAA terminator independent of Escherichia coli Rho, its sequence is 5'-GA AG GCCGCTTCC GAAA GGAAGCGGC T TTTTT-3' (the underline indicates the paired stem-loop sequence in the terminator), named heat shock terminator (Hsh terminator, figure 1 ).
[0041] (2) Amplification and assembly method of each element of the plasmid vector:
[0042] Design and synthesize a pair of primers with a novel promoter or terminator, their sequence is: 5'-CCG GAATTC CTCCTTGGATC ATGGGGATGTTTCCCCCACATTCAAGGGGG CTCTTCCGCT TCCTCTC -3' and 5'-TGAAGCTTGAAGGCCGCTTC CGAAAGGAAG CGGCTTTTTT ...
Embodiment 2
[0048] Embodiment 2: basically the same as Example 1, the difference is that the promoter is the promoter of Escherichia coli heat shock protein gene lon, and its sequence is 5'-CGGCGTTGAA TGTGGGGGAA ACATCCCCAT ATACTGACGTA-3'(lon), designed with The primers of lon heat shock protein promoter were amplified by DNA polymerase Pyrobest, phosphorylated by T4 DNA kinase and circularized by T4 DNA ligase to obtain a new vector pHsh-lon.
Embodiment 3
[0049] Embodiment 3: substantially the same as Example 1, the difference is that the promoter is the promoter of the Escherichia coli heat shock protein gene dnaK P1, and its sequence is 5'-CCCCCTTGAT GACGTGGTTT ACGACCCCAT TTAGTAGTCA-3' (dnaK P1), the design band The primers with dnaK P1 heat shock protein promoter were amplified by DNA polymerase Pyrobest, phosphorylated by T4 DNA kinase and circularized by T4 DNA ligase to obtain a new vector pHsh-dK.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com