Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA

A non-coding, Streptococcus mutans technology, applied in the field of oral disease treatment and prevention, can solve the problem of lack of ideal caries treatment effect Streptococcus mutans mutant strains, etc., to reduce the number, prevent the occurrence and development, and adjust the oral flora imbalance. Effect

Pending Publication Date: 2022-08-02
STOMATOLOGICAL HOSPITAL OF CHONGQING MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The present invention intends to provide an application of non-coding RNA in the preparation of caries-preventing Streptococcus mutans, so as to solve the technical problem in the prior art that there is no mutant strain of Streptococcus mutans with ideal caries treatment effect and simple preparation method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA
  • New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA
  • New application of non-coding RNA (Ribonucleic Acid) and streptococcus constructed by non-coding RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: Analysis of clinical isolates

[0039] To isolate and collect dental plaque from caries-free / severe young children with caries, culture and isolate Streptococcus mutans by conventional means in the prior art, and use conventional RT-qPCR to detect AsvicK (antisensevicK RNA, ASvicK) in the isolated Streptococcus mutans. ) relative expression, the experimental results are as follows figure 1 As shown, the figure shows the relative expression of ASvicK in dental plaque in caries-free children (CF) and severe young children with caries (SECC) (n=8; * means p less than 0.05). The expression of ASvicK was increased in caries-free children, suggesting that ASvicK is closely related to cariogenicity.

[0040] RT-qPCR primers are as follows:

[0041] First-strand synthetic translation primer: 5'-TCACGTATTGATAATCAGACCAGTC-3';

[0042] Sense strand PCR primer: 3'-GTCGTTAGTTGATTATTCCAAATGC-5'

[0043] (ie: 5'-CGTAAACCTTATTAGTTGATTGCTG-3').

Embodiment 2

[0044] Example 2: Construction of ASvicK Overexpression Strain (Antisense vicK Gene Mutant Strain)

[0045] (1) Construction of recombinant plasmid

[0046] The long non-coding RNA (ASvicK) used in this protocol is named antisense vicK RNA (antisensevicK RNA, ASvicK). The secondary structure prediction results of ASvicK are as follows figure 2 shown. The gene sequence of ASvicK is shown in SEQ ID NO.1 (5'→3'):

[0047] TTTCAATCCAAACTGATTTGTCAGGATAATCTCTAATAATTTCGTAAACCTTATTAGTTGATTGCTGACTTTGAATTTGATCAAAGCGATCCAGAATATAATTCATAAAAGCTGTAAAATTCGTCAATTCAACATCTAGATGACTGGTCTGATTATCAATACGTGATAAGCTAAGTAAATCAGTAATCATACGCATCATGCGATTAGTCTCATCAAGTGATACCTTGATAAAGCTAG(SEQ ID NO. 1);

[0048] The sequence of the vicK gene is shown in SEQ ID NO.2 (5'→3'):

[0049] ATGACTAATGTGTTTGAATCAAGTCCCTTATTTTTACGAATTTTATTAGCAGTTTTAATCATTTTACTCTTTTTTTATTTTATTTTTCTCAATTACAGAGAGTATAAAAATAATAATCAAGTTAAACAGTTAAATGCTAAAGTACGTTCTTTGATTACTGGCCATTATACTGATAAATTAAAGGTTGAGGATAACTCTGACTTGTCAGAACTAGTGAATAACGTTAATG...

Embodiment 3

[0059] Example 3: Experiment on biofilm performance of mutant strains

[0060] Bacterial biofilm (or Bacterial biofilm, BF) refers to a large number of bacterial aggregated membranes formed by bacteria that adhere to the contact surface, secrete polysaccharide matrix, fibrin, lipid protein, etc. thing. The polysaccharide matrix usually refers to the polysaccharide protein complex, and also includes the organic matter and inorganic matter precipitated from the surrounding. Bacterial biofilm is a life phenomenon that is beneficial to the survival of bacteria in order to adapt to the natural environment. It is formed by the accumulation of microorganisms and their secretions.

[0061] The biofilm formation ability of the mutant strains was detected by crystal violet staining. After the three strains were stained with crystal violet, the absorbance value at 595 nm was measured, and the experimental results were as follows Figure 7 shown. Compared with UA159, the total amount ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of oral disease treatment and prevention, in particular to novel application of non-coding RNA and streptococcus constructed by the non-coding RNA. The invention discloses application of non-coding RNA (Ribonucleic Acid) in preparation of streptococcus mutans with reduced cariogenic ability. The sequence of the non-coding RNA is shown as SEQ ID NO. 1. According to the scheme, the research finds that the expression quantity of non-coding RNA in dental plaque of children without caries is increased, the inventor constructs an ASvicK overexpression strain, confirms that ASvicK can regulate and control vicK gene expression, and finds that ASvicK can change the growth form of streptococcus mutans and interfere exopolysaccharide metabolism and cariogenic property of streptococcus mutans. According to the scheme, the technical problem that a streptococcus mutans mutant strain which has an ideal caries treatment effect and is simple in preparation method is lacked in the prior art is solved, and the obtained strain can be used for adjusting oral flora imbalance, reducing the number of streptococcus mutans with high cariogenic capacity and preventing occurrence and development of caries.

Description

technical field [0001] The invention relates to the technical field of oral disease treatment and prevention, in particular to a new use of a non-coding RNA and a streptococcus constructed therefrom. Background technique [0002] Caries is a chronic and progressive infectious disease that occurs in the hard tissue of teeth, and its occurrence and development are closely related to dental plaque biofilm. Streptococcus mutans is the most important pathogenic bacteria in the process of caries occurrence and development. It can utilize sugars in food to produce organic acids and synthesize exopolysaccharides, thereby causing increased activity of acid-resistant cariogenic flora and imbalance of microecology. lead to caries. The exopolysaccharide synthesized by Streptococcus mutans is an important virulence factor and material energy source. The amount, composition and structure of exopolysaccharide are closely related to the occurrence and development of caries. At the same ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/66C12N15/74C12N1/21C12N9/12A61K35/744A61P1/02C12R1/46
CPCC12N15/1137C12N15/66C12N15/746C12N9/12C12Y207/13A61K35/744A61P1/02C12N2310/14C12N2800/101Y02A50/30
Inventor 杨德琴陈虹孙雨婷许萌萌
Owner STOMATOLOGICAL HOSPITAL OF CHONGQING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com