Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ELISA (Enzyme-Linked Immunosorbent Assay) detection method of avian exosome

A detection method, exosome technology, applied in the direction of measuring devices, biological testing, material inspection products, etc., can solve the problems of cumbersome operation, different sensitivity, complicated steps, etc., and achieve the effect of large application prospect and wide application range

Pending Publication Date: 2022-05-13
JILIN UNIV
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the samples targeted by traditional flow cytometry are mainly cells, the detection limit of scattered light is usually 300-500nm, and the diameter of most extracellular vesicles is below 300nm, so it is difficult to carry out accurate quantitative and qualitative analysis; in addition , flow cytometry analysis can generally only detect one marker at a time, and exosomes are too small. When the existing flow cytometry equipment detects, it needs to bind the magnetic beads coated with foreign antibodies first, and the operation requires sophisticated instruments. equipment, and the operation is cumbersome and the sensitivity varies), Western blot detection technology (complex operation process) and fluorescent quantitative PCR detection and analysis of microRNA (the extraction of nucleic acid is complicated and requires expensive experimental equipment)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ELISA (Enzyme-Linked Immunosorbent Assay) detection method of avian exosome
  • ELISA (Enzyme-Linked Immunosorbent Assay) detection method of avian exosome
  • ELISA (Enzyme-Linked Immunosorbent Assay) detection method of avian exosome

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] The ELISA detection method of poultry-derived exosomes provided in this application uses poultry-derived CD63 as the target, so it is first necessary to prepare relevant recombinant proteins for subsequent detection and application. Therefore, this example first introduces the preparation process of related recombinant proteins as follows.

[0068] (1) Design primers and carry out PCR amplification

[0069] According to the existing poultry CD63 sequence, the coding sequence (2142bp, as shown in SEQ ID No.1) was redesigned as follows by optimizing the codons, excising the signal peptide, and introducing XhoI and NheI restriction sites and His tags at the same time:

[0070]GCTAGCATGGAGGAACTCCGCGTTGCGTTTTCTATTCTGGTACTGTGTGCCGCAGGTTCTTGGGGTTCCAACATTTGTGCAACTCGTGGCGTGACCTCTTGTAAACAGTGCCTGGCTGTTTCTCCGCTGTGTGCATGGTGCTCCGCCGAAGTTGTTGCCCAGTCTACCCCACGTTGCGATCTGTTCGCAAACCTGCTGCAGAACGGTTGCGGTCGTGATTTTATTGAATTCCCGCGTTCTTCCATCACGGTTCTGGAAGAACGTCCACTGTCCGATAAAGGTTCCGGCGGTAGCACTACCAC...

Embodiment 2

[0090] Using the CD63 protein and its corresponding antibody prepared in Example 1, the inventors further drew a standard curve.

[0091] (1) Sample preparation

[0092] Collect the serum-free supernatant of cells from healthy chickens, centrifuge at room temperature (25°C) and 2000g for 15 minutes to remove cells and their debris, and keep the supernatant;

[0093] Centrifuge the supernatant after the above centrifugation at 4°C and 100,000g for 60 minutes, and leave the precipitate (the retained precipitate is poultry-derived exosomes);

[0094] Resuspend the pellet (exosomes) with PBS (pH 7.0), and the prepared resuspension is the exosome resuspension;

[0095] Dilute the obtained exosome suspension into standard products with different concentrations according to the 10-fold serial dilution method;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of poultry disease detection, and particularly relates to a patent application of an ELISA (enzyme-linked immuno sorbent assay) detection method for poultry-derived exosomes. The ELISA detection method of the poultry-derived exosome comprises the steps of sample preparation, coating, sealing, sample adding, detection, result judgment and the like. In the prior art, human-derived exosome surface marker proteins CD9 and CD81 are taken as targets in an exosome-based ELISA detection method, but the marker proteins are not suitable for poultry, namely, the marker proteins are not suitable for detecting poultry-derived exosomes. Therefore, the poultry-derived exosome surface marker protein CD63 is used as a marker, poultry-derived CD63 protein is prepared, corresponding multi-antibody serum is prepared, and on the basis, an ELISA detection method of the poultry-derived exosome is further designed and developed, so that a certain technical foundation can be laid for poultry-related physiological work research.

Description

technical field [0001] The invention belongs to the technical field of poultry disease detection, and specifically relates to a patent application for an ELISA detection method of poultry-derived exosomes. Background technique [0002] Exosome is a vesicle-shaped biological device containing RNA, protein and other substances with a particle size of about 40-100 nm. Most of the currently known biological cells can synthesize and release exosomes. Studies have shown that exosome membranes are rich in lipid rafts, which complete the release process from intracellular to extracellular by fusing with cell membranes. In early studies, people always thought that exosomes only had the function of participating in the transport of substances between cells. It was not until the information transmission function of exosomes between cells was discovered that researchers were able to understand the production methods and specific functions of exosomes. and its mechanism of action. It i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/543G01N33/535G01N33/68C12N15/70
CPCG01N33/543G01N33/535G01N33/68C12N15/70G01N2333/70596
Inventor 徐小洪丁壮丁伟邹映雪黄天鸿曲书靚苏佳鑫刘婷婷
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com