Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of PCR kit

A technology of cell culture and mycoplasma, applied in the field of PCR, can solve the problems of poor broad-spectrum, high price, and shortened detection time, and achieve the effect of accurate and reliable data, simple operation, and rapid detection

Pending Publication Date: 2022-04-15
苏州鉴达生物科技有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Although the detection time of the PCR method is greatly shortened compared with the traditional separation and culture method, there are still some problems in the existing PCR mycoplasma detection, such as poor primer design, resulting in insufficient detection sensitivity and specificity; moreover, the current mainstream detection kits can only For one or several kinds of mycoplasma, the broad spectrum is poor
[0010] Although qPCR can avoid the false positive results of ordinary PCR aerosols and improve detection sensitivity, it needs to be equipped with expensive fluorescent quantitative PCR instruments, and the equipment maintenance costs are high, the machine setting and operation are complicated, and it is difficult to be fully popularized.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of PCR kit
  • PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of PCR kit
  • PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of PCR kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1 Application Verification of PCR Detection Kit

[0053] In this example, the specific implementation of mycoplasma detection on the DNA samples of 5 cell lines K562, Hep3B, THP1, A20, and YAC-1. The five cell lines were all contaminated by mycoplasma, among which K562, Hep3B, THP1 were commonly used human cell lines; A20, YAC-1 were commonly used mouse cell lines.

[0054] 1. DNA extraction

[0055] The Chelex100 crude extraction method was used to extract the whole genome DNA from the four cell lines. Take 1000 μL of cell suspension, shake and centrifuge at 10,000 rpm for 3 minutes, discard the supernatant, add 200 μL of 5% Chelex100 suspension and 3 μL of PK 10 mg / mL, bathe in water at 56°C for 1 hour, shake slightly, then take a boiling water bath for 8 minutes, shake for 10 seconds, and centrifuge at 10,000 rpm for 3 minutes. The supernatant was used for later use. After the DNA was extracted, it was quantified with a UV spectrophotometer and diluted to ...

Embodiment 2

[0072] Example 2 The specificity verification result of PCR detection kit

[0073] In this example, the specificity of the kit was verified by detecting the DNA of five cell lines. The five cell lines are all K562 cells, K562-1 is a normal strain without any pollution; K562-2 is a strain infected by pseudorabies virus; K562-3 is a strain infected by Escherichia coli; K562-4 is a strain infected by Mycoplasma hyorhina strain; K562-5 is a strain infected by Mycoplasma gallisyoviolum. The PCR detection kit described in this example was used to amplify the genomic DNA of the above five K562 cell lines and perform capillary electrophoresis on a 3130xl genetic analyzer.

[0074] 1. DNA extraction

[0075] The Chelex100 crude extraction method was used to extract the whole genome DNA from the four cell lines. Take 1000 μL of cell suspension, shake and centrifuge at 10000 rpm for 3 minutes, discard the supernatant, add 200 μL of 5% Chelex100 suspension and 3 μL of PK 10 mg / mL, bath...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of the PCR kit. The composition disclosed by the invention comprises the following sequences: (1) an upstream primer Primer-Myc-F: TGAGTAGTATGCTCGCAAGAGTG, (2) an upstream primer, (3) a downstream primer, (4) an upstream primer and (5) a downstream primer, wherein the upstream primer is used for PCR (Polymerase Chain Reaction) amplification of a mycoplasma nucleic acid sequence; and (2) a downstream primer Primer-Myc-R: CGACACGAGCTGACGACAAC, which is used for carrying out PCR (Polymerase Chain Reaction) amplification on the nucleic acid sequence of the mycoplasma. The composition can be used for preparing a PCR kit. The composition or the kit can be used for mycoplasma detection. Compared with the existing PCR (Polymerase Chain Reaction) primer amplification method, the primer pair disclosed by the invention is optimized, so that Primer-BLAST shows that 528 products can be amplified, and the primer pair has high spectral property.

Description

technical field [0001] The invention belongs to the technical field of PCR, in particular to a PCR kit for detecting mycoplasma contamination in cell culture and an application thereof. Background technique [0002] Mycoplasma (mycoplasma), also known as mycoplasma, is a prokaryotic microorganism that is similar to bacteria but does not have a cell wall discovered by Nocard in 1898. It can grow and reproduce on inanimate artificial media, and is the smallest and simplest found so far. prokaryotes. The Mycoplasma genome is a circular double-stranded DNA with a small molecular weight (only one-fifth of that of E. coli), and the number of genes is 480. [0003] In the process of cell culture, mycoplasma pollution has become a worldwide problem, and about 30%-60% of cell cultures have mycoplasma pollution. The main reasons for this situation are as follows: Mycoplasma is very small in size, 0.1-0.3um, and generally cannot be removed by filters; Mycoplasma is changeable in shap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12N15/11C12R1/35
Inventor 赵宪坤
Owner 苏州鉴达生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com