3-ketoacyl-CoA thiolase gene RkACAA1-1 and application thereof
A technology of thiolase and ketoacyl, which is applied in the fields of biology and genetic engineering, can solve the problems of high cost, chemical residues and unfriendly environment of plant extraction method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: From Rhodosporidium ( Rhodosporidium kratochvilovae ) 3-ketoacyl-CoA thiolase gene isolated from YM25235 RkACAA1 The nucleotide sequence and the construction of the overexpression vector pRHRkACAA1-1
[0018] The total RNA of Rhodosporidium YM25235 was extracted by UNlQ-10 Column Trizol Total RNA Extraction Kit (Product No.: SK1321) from Sangon Bioengineering (Shanghai) Co., Ltd. R212-02) HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) was used for reverse transcription to synthesize cDNA, and 1 μL of cDNA was used as a template for polymerase chain reaction. RkACAA1-1 Sequence, design specific primers RkACAA1-1-F and RkACAA1-1-R, use the cDNA template obtained above to carry out PCR amplification on a PCR machine (Beijing Liuyi Biotechnology Co., Ltd.), and the primers, components and amplification used in the reaction are used. The additional conditions are as follows:
[0019] RkACAA1-1-F: 5'- ATCACTCACCATGGCGGATCC TATGTCTCTCACGAACGCCG -3' (...
Embodiment 2
[0027] Example 2: RkACAA1-1 Effects of gene overexpression on carotenoid synthesis in Rhodosporidium YM25235
[0028] 1. Transform Rhodosporidium YM25235
[0029] Pick the single clone of DH5α strain successfully transformed into the correct recombinant vector pRHRKACAA1-2 and insert it into LB liquid medium (containing 100 µg / mL spectinomycin) for overnight culture, extract the plasmid (OMEGA Plasmid Mini Kit I, OMEGA, USA), put it in Store at -20 °C for later use; pick a single colony of Rhodosporidium YM25235 and inoculate it in 5 mL of YPD liquid medium, and shake at 30 °C and 200 rpm overnight; transfer the overnight cultured bacterial solution to 1% of the inoculum. In 50 mL of YPD liquid medium, shake at 30 °C and 200 rpm to culture to the OD of the bacterial liquid 600 To 0.5, the culture medium was centrifuged at 4°C and 4500 rpm for 5 min to collect bacteria; the bacteria were washed with previously prepared citric acid buffer (30 mM citric acid, 83 mM sodium citra...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com