Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genetically engineered bacterium community based on artificial design as well as construction method and application of genetically engineered bacterium community

A technology of genetically engineered bacteria and construction method, which is applied in the field of genetically engineered bacterial community based on artificial design and its construction to achieve the effects of reducing the separation and purification process, increasing the content and maintaining the activity of enzymes

Active Publication Date: 2021-10-01
HUNAN AGRI PRODS PROCESSING INST
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved in the present invention is, in the face of the urgent problem to be solved, seek a kind of artificially designed genetically engineered bacterial community and its method for obtaining hesperetin in a green way build method and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium community based on artificial design as well as construction method and application of genetically engineered bacterium community
  • Genetically engineered bacterium community based on artificial design as well as construction method and application of genetically engineered bacterium community
  • Genetically engineered bacterium community based on artificial design as well as construction method and application of genetically engineered bacterium community

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] A kind of recombinant engineering bacterium BL21 (DE3) of the present invention is constructed by the following method:

[0058] (1) Download the Gentiana-derived flavonoid 3'hydroxylase F3'H (GtF3'H) nucleotide sequence on Genbank, and optimize the codon of Escherichia coli, its specific sequence is shown in SEQ ID NO.1 show, specifically:

[0059] tctcgtaaaaaaggtcacggtcgttctctgccgctgccgccgggtccgcgtccgtggccgatcctgggcaacatcccgcacctgggctccaaaccgcaccagaccctggcggaaatggctaaaacctacggtccgttgatgcacctgaaattcggcctgaaagatgcggtggttgcgtccagcgcatccgtagctgaacagttcctgaaaaaacacgatgttaacttctctaaccgtccgccgaacagcggtgcaaaacacatcgcttacaactatcaggatctggtgttcgctccgtatggtccgcgctggcgtttgctgcgtaaaatttgctccgttcacctgttcagctccaaagcgctggacgatttccagcacgttcgccatgaagaaatttgcatcctgattcgtgcaattgcgtctggcggtcatgcgccggttaacctgggtaaactgctgggcgtttgcaccaccaacgctctggcgcgtgttatgctgggtcgtcgtgttttcgaaggcgatggcggtgaaaacccgcacgcggacgagttcaaatccatggttgtagaaatcatggttctggcgggtgctttcaacctgggtgatttcattccggttctggactggtttgac...

Embodiment 2

[0079] A kind of recombinant engineering bacterium of the present invention is constructed by the following method:

[0080] (1) Construction of recombinant plasmid pET32a-SumoMpOMT

[0081] Download the nucleotide sequence of flavonoid 4'-O-methyltransferase (MpOMT) from Genbank, optimize the codon in Escherichia coli, and express it in fusion with Sumo. The specific sequence of MpOMT is shown in SEQ ID NO.3. Specifically:

[0082] atggttgctgatgaagaagttcgtgttcgtgcggaagcatggaacaacgcgttcggttacatcaaaccgaccgcagttgcgaccgcggttgaactgggtctgccggatatcctggaaaaccacgatggtccgatgagcctgctggaactgagcgcggctaccgattgcccggccgaaccgctgcaccgtctgatgcgtttcctggttttccacggtatcttcaaaaagaccgcgaaaccgccgctgtctaacgaagcggtttactacgcgcgtaccgcgctgagccgcctgttcacccgtgacgaactgggtgacttcatgctgctgcagaccggtccgctgtctcagcacccggctggcctgaccgcgtccagcctgcgcaccggtaaaccgcagttcatccgtagcgtgaacggcgaagattcttggaccgatccggttaacggttaccacatgaaagttttctccgatgcgatggcggcgcacgcacgcgaaaccaccgcggcgatcgttcgttactgcccggcggcgttcgaaggtatcggtaccgttgt...

Embodiment 3

[0096] A genetically engineered bacterial community based on artificial design, including the recombinant engineered bacteria 1 of embodiment 1 and the reengineered bacteria 2 of embodiment 2, the mass ratio of the recombinant engineered bacteria 1 and the repeatedly engineered bacteria 2 is 1:3.

[0097] A method for constructing the genetically engineered bacterial community of the present embodiment 1, specifically comprising the following steps:

[0098] 1. Cultivate recombinant engineered bacteria 1:

[0099] 1.1. The recombinant engineered bacteria 1 was cultured overnight at a constant temperature of 37°C in a solid LB medium containing ampicillin resistance.

[0100] 1.2. Pick a single colony on the solid LB medium plate and put it into a test tube of LB liquid medium containing ampicillin, and culture it at 37°C and 220 rpm for 12 hours.

[0101] 1.3. Inoculate in 30mL LB liquid medium containing ampicillin resistance according to the inoculation ratio of 1%, and cul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetically engineered bacterium community based on artificial design and a construction method and application thereof. The genetically engineered bacterium community based on artificial design comprises a recombinant engineering bacterium 1 containing a GtF3 'H gene and a CPR gene and a recombinant engineering bacterium 2 containing an MpOMT gene. The construction method comprises the following steps: constructing a recombinant engineering bacterium 1 and a recombinant engineering bacterium 2; culturing into a culture solution; and mixing to obtain the genetically engineered bacterium community. In the genetically engineered bacterium community, GtF3 'H catalyzes a hydroxylation reaction of a substrate naringenin to synthesize an intermediate product eriodictyol, CPR is a cofactor for the GtF3' H to perform a catalytic function and transfers electrons of NADPH to GtF3 'H to perform a hydroxylation reaction, and MpOMT catalyzes an oxygen methylation reaction of the intermediate product eriodictyol to synthesize hesperetin.

Description

technical field [0001] The invention relates to the field of biochemical technology, in particular to a genetically engineered bacterial community based on artificial design and its construction method and application. Background technique [0002] Citrus flavonoids have antioxidant and antiviral effects, and have good preventive and therapeutic effects on cardiovascular diseases, neurodegenerative diseases, and cancer. With the increasing market demand for flavonoids, the extraction of citrus flavonoids from plants has the characteristics of high input, high consumption, high pollution and low output, which limits the mass production of flavonoids. Chemical synthesis involves the use of chemical reagents and harsh reaction conditions. The use of flavonoids in food and health products may cause safety problems. Microbial synthesis of citrus flavonoids has the advantages of environmental friendliness and resource conservation, and is in line with the application prospects of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P17/06C12R1/19
CPCC12N15/70C12N9/0042C12N9/0073C12Y106/02004C12Y114/13088C12P17/06
Inventor 单杨刘娟田苗苗王振
Owner HUNAN AGRI PRODS PROCESSING INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com