Genetically engineered bacterium community based on artificial design as well as construction method and application of genetically engineered bacterium community
A technology of genetically engineered bacteria and construction method, which is applied in the field of genetically engineered bacterial community based on artificial design and its construction to achieve the effects of reducing the separation and purification process, increasing the content and maintaining the activity of enzymes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] A kind of recombinant engineering bacterium BL21 (DE3) of the present invention is constructed by the following method:
[0058] (1) Download the Gentiana-derived flavonoid 3'hydroxylase F3'H (GtF3'H) nucleotide sequence on Genbank, and optimize the codon of Escherichia coli, its specific sequence is shown in SEQ ID NO.1 show, specifically:
[0059] tctcgtaaaaaaggtcacggtcgttctctgccgctgccgccgggtccgcgtccgtggccgatcctgggcaacatcccgcacctgggctccaaaccgcaccagaccctggcggaaatggctaaaacctacggtccgttgatgcacctgaaattcggcctgaaagatgcggtggttgcgtccagcgcatccgtagctgaacagttcctgaaaaaacacgatgttaacttctctaaccgtccgccgaacagcggtgcaaaacacatcgcttacaactatcaggatctggtgttcgctccgtatggtccgcgctggcgtttgctgcgtaaaatttgctccgttcacctgttcagctccaaagcgctggacgatttccagcacgttcgccatgaagaaatttgcatcctgattcgtgcaattgcgtctggcggtcatgcgccggttaacctgggtaaactgctgggcgtttgcaccaccaacgctctggcgcgtgttatgctgggtcgtcgtgttttcgaaggcgatggcggtgaaaacccgcacgcggacgagttcaaatccatggttgtagaaatcatggttctggcgggtgctttcaacctgggtgatttcattccggttctggactggtttgac...
Embodiment 2
[0079] A kind of recombinant engineering bacterium of the present invention is constructed by the following method:
[0080] (1) Construction of recombinant plasmid pET32a-SumoMpOMT
[0081] Download the nucleotide sequence of flavonoid 4'-O-methyltransferase (MpOMT) from Genbank, optimize the codon in Escherichia coli, and express it in fusion with Sumo. The specific sequence of MpOMT is shown in SEQ ID NO.3. Specifically:
[0082] atggttgctgatgaagaagttcgtgttcgtgcggaagcatggaacaacgcgttcggttacatcaaaccgaccgcagttgcgaccgcggttgaactgggtctgccggatatcctggaaaaccacgatggtccgatgagcctgctggaactgagcgcggctaccgattgcccggccgaaccgctgcaccgtctgatgcgtttcctggttttccacggtatcttcaaaaagaccgcgaaaccgccgctgtctaacgaagcggtttactacgcgcgtaccgcgctgagccgcctgttcacccgtgacgaactgggtgacttcatgctgctgcagaccggtccgctgtctcagcacccggctggcctgaccgcgtccagcctgcgcaccggtaaaccgcagttcatccgtagcgtgaacggcgaagattcttggaccgatccggttaacggttaccacatgaaagttttctccgatgcgatggcggcgcacgcacgcgaaaccaccgcggcgatcgttcgttactgcccggcggcgttcgaaggtatcggtaccgttgt...
Embodiment 3
[0096] A genetically engineered bacterial community based on artificial design, including the recombinant engineered bacteria 1 of embodiment 1 and the reengineered bacteria 2 of embodiment 2, the mass ratio of the recombinant engineered bacteria 1 and the repeatedly engineered bacteria 2 is 1:3.
[0097] A method for constructing the genetically engineered bacterial community of the present embodiment 1, specifically comprising the following steps:
[0098] 1. Cultivate recombinant engineered bacteria 1:
[0099] 1.1. The recombinant engineered bacteria 1 was cultured overnight at a constant temperature of 37°C in a solid LB medium containing ampicillin resistance.
[0100] 1.2. Pick a single colony on the solid LB medium plate and put it into a test tube of LB liquid medium containing ampicillin, and culture it at 37°C and 220 rpm for 12 hours.
[0101] 1.3. Inoculate in 30mL LB liquid medium containing ampicillin resistance according to the inoculation ratio of 1%, and cul...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com