Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit and method for identifying Eospalax species

A kit and species technology, applied in the field of identification, can solve the problems of difficult identification, inconspicuous identification features of juvenile and sub-adult skulls, difficulty in accurate identification of species, etc., and achieve the effect of simple method and good specificity.

Pending Publication Date: 2021-09-24
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the similar living environment of different zokors, the morphology converges, especially the morphological identification of the genus Zokor is difficult, and the identification features of juvenile and subadult skulls are not obvious. It is very difficult to accurately identify species through morphology without professional taxonomic training.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for identifying Eospalax species
  • Kit and method for identifying Eospalax species
  • Kit and method for identifying Eospalax species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Embodiment 1, the present invention distinguishes the test kit of convex skull zokor

[0087] The components of the kit of the present invention include:

[0088] (1) PCR amplification reagent: primer pair comprising SEQ NO: 1-2 and SEQ NO: 3-4; (2) Reagent for sequencing.

Embodiment 2

[0089] Embodiment 2, PCR primer design and verification of SNP site

[0090] The inventors compared the mitochondrial genome sequences of 121 individual zokors from 8 zokor species and found that there were 8 species-specific SNPs in the 12S rRNA gene and 6 species-specific SNPs in the 16S rRNA gene .

[0091] 121 individual zokors from 8 zokor species, including 12 prairie zokors, 10 northeast zokors, 15 Chinese zokors, 18 Stryn's zokors, 16 Roche zokors, 14 plateau zokors, Gansu zokors There were 24 zokors and 12 Qinling zokors.

[0092] 12S rRNA, 16S rRNA and nearby gene sequences were designed as primers in the conserved regions as follows:

[0093] ME12S-1L: AGCACTGAAAATGCTTAGATGG (SEQ ID NO: 1);

[0094] ME12S-1R: CGGCTAAGCATAGTGGGGTA (SEQ ID NO: 2).

[0095] ME16S-1L: AGAGGAGATAAGTCGTAACAAGGT (SEQ ID NO: 3)

[0096] ME16S-1R: TCCTGATCCAACATCGAGGT (SEQ ID NO: 4)

[0097] The above primers were used to amplify the DNA samples of different zokor species, and confirme...

Embodiment 3

[0117] Embodiment 3, species identification of the convex-headed zokor

[0118] First, a pair of primers for 12S rRNA gene fragments (SEQ ID NO:1 and SEQ ID NO:2) and a pair of primers for 16S rRNA gene fragments (SEQ ID NO:3 and SEQ ID NO:4) were synthesized.

[0119] Use the following methods to identify:

[0120] a) Using the Qiagen DNeasy Blood&Tissue Kit kit, extract the genomes of zokor tissue samples numbered ZYX-4, MX-16, ZBX-4, TCX-7, CD-8, FFX-5, and WCX-3 total DNA;

[0121] b) Using the total genomic DNA described in step a) as a template, use the 12S rRNA primer pair and the 16S rRNA primer pair to perform PCR reactions respectively, the annealing temperature of ZYX-4 is 52°C, the annealing temperature of MX-16 is 56°C, 4 Annealing temperature 52°C, TCX-7 annealing temperature 56°C, CD-8 annealing temperature 56°C, FFX-5 annealing temperature 56°C, WCX-3 annealing temperature 55°C.

[0122] c) Perform 1% agarose gel electrophoresis detection on the PCR product ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for identifying Eospalax species. The kit comprises reagents for detecting the following 14 SNP sites of a species to be detected: the 37 site of a conserved motif sequence shown in SEQ ID NO: 5 in a 12S rRNA gene, the 18 site of a conserved motif sequence shown in SEQ ID NO: 6, the 33<rd> site of a conserved motif sequence shown in SEQ ID NO: 7, the 7 site of a conserved motif sequence shown in SEQ ID NO: 8, the 47 site of a conserved motif sequence shown in SEQ ID NO: 11, the 1 site and the 2<nd> site of a conserved motif sequence shown in SEQ ID NO: 13, the 4 site of a conserved motif sequence shown in SEQ ID NO: 14, and the 25 site of a conserved motif sequence shown in SEQ ID NO: 15; and the 33<rd> site of a conserved motif sequence shown in SEQ ID NO: 9 in a 16S rRNA gene, the 34 site of a conserved motif sequence shown in SEQ ID NO: 10, the 35 site of a conserved motif sequence shown in SEQ ID NO: 12, and the 22<nd> site and the 31 site of a conserved motif sequence shown in SEQ ID NO: 16. The kit can simply and accurately identify the species of individuals in Eospalax, solves the problem of identifying the Eospalax species through morphology, and has excellent application prospects.

Description

technical field [0001] The invention belongs to the technical field of identification, and in particular relates to a kit and a method for identifying the species of protruding-headed zokor. Background technique [0002] Zokor is a collective name for animals in the subfamily Myospalacinae, and it is a rodent adapted to living underground. [0003] Zokor is stout and cylindrical, with a broad and flat head, with tentacles on the head, blunt nose with exposed nose pads, short tail and limbs, extremely small eyes, poor vision, almost covered by hair, and degenerated auricles. Hidden under the hair. Zokors live in camp all their lives, and occasionally come to the ground at night. Zokors dig burrows very fast. They dig soil with their forelimbs and push soil with their heads. Each individual has an independent burrow system. The tunnel is long and complex in structure. A mound or bulge is formed above the tunnel. The main tunnel has many branches. , the tunnel has no obvious...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q2600/156C12Q2531/113C12Q2535/101C12Q2565/125
Inventor 蔡振媛张同作张毓张婧捷宋鹏飞高红梅江峰汪海静刘道鑫李斌徐波侯陆一
Owner CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com