Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application

An antibody detection and kit technology is applied in the field of deer epidemic hemorrhagic fever virus blocking ELISA antibody detection kits, which can solve problems such as the impact of ruminant breeding industry, improve sensitivity and specificity, avoid virus spread, improve Effects of sensitivity and specificity

Active Publication Date: 2021-06-29
SHENZHEN CUSTOMS ANIMAL & PLANT INSPECTION & QUARANTINE TECH CENT
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These studies show that EHDV is widely distributed in my country, and there is a risk of outbreaks that may have a significant impact on my country's ruminant breeding industry. It is necessary to carry out research and development of EHD diagnostic reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application
  • Blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application
  • Blocking ELISA antibody detection kit based on EHDV core-like particles, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0065] Preparation and purification of example 1 EHDV core-like particles

[0066] (1) Construction of recombinant bacmid Bacmid-vp3-vp7

[0067] By subcloning, the EHDV vp3 gene (SEQ ID NO.1) and vp7 gene (SEQ ID NO.2) were sequentially inserted into the vector pFastBac TM Dual, to construct the recombinant plasmid pFastBac-Dual-vp3-vp7, see its structure figure 1 . The recombinant plasmid pFastBac-Dual-vp3-vp7 with correct sequencing was transformed into DH10Bac, and the recombinant bacmid-vp3-vp7 was obtained by screening by blue-white spot and colony PCR.

[0068] Said SEQ ID NO.1 is as follows:

[0069]ATGGCAGATCCACCAGATGCAAATGCACCAAAAACGAGTCCGTATCTAAAAGGAGATGAGTTATCAAGTGACAGTGGACCTTTGCTTTCAATCTTCGCTCTACAAGAGATTATGCAAAAGGTGCGACAAGCGCAATCGGAGTATGTTGCAGCAACTAAAGATGTCGATCTAACGGTACCGGATGTTCAAAAAATAATCGATGGAGTTAAAGAGCTGGCCTCAGAGACGATCTATAAAATTGTACAGAAACCCATCATCTCGTATAGGCATGTGGTGATGCAATCAAGGGATAGATTTCTCCGGGTGGACACCTATTATGAAAGGATGTCTGAAGTTGGCGATAAGATAGATGAGAATGAACCCGCGAAATTT...

example 2

[0078] Example 2 Establishment of a blocking ELISA method based on EHDV core-like particles

[0079] (1) Determination of the most suitable coating solution

[0080] The difficulty in establishing an ELISA method using EHDV CLPs as a coating antigen is that the coating process must ensure that the morphological structure of EHDV CLPs is not damaged by the coating solution. For this reason, the present invention is to determine the most suitable coating liquid, coating liquid is respectively set to the bicarbonate buffer (CB) of 0.05M pH9.6, the hydrogen phosphate buffer (PBS) of 0.2M pH7.4 , 0.2M pH8.0 Tris hydrochloric acid buffer (TB) and 0.1M pH8.0 Tris hydrochloric acid buffer, the purified EHDVCLPs were diluted with these buffers, and the particle morphology was observed under a transmission electron microscope. Results (see Figure 5 ) showed that after dilution with 0.05M pH9.6 bicarbonate buffer (CB) as the coating solution, the structure of EHDV CLPs was completely ...

example 3

[0111] Determination results of the critical value of Example 3

[0112] Detect 80 known EHDV-negative sera according to the established blocking ELISA operating procedure, and read the OD 450nm Value, the results were statistically analyzed to calculate the average blocking rate of serum samples is 10.5%, and the standard deviation (s) is 4.62%,

[0113] When the blocking rate PI≥24.36%, it is judged as positive,

[0114] When the blocking rate PI≤19.74%, it is judged as negative,

[0115] When the blocking rate is 19.74%

[0116] The test needs to be repeated once, and if it is still lower than 24.36%, it is judged as negative for serum antibodies.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a blocking ELISA antibody detection kit based on deer epidemic hemorrhagic fever virus (EHDV) core-like particles (CLPs) as well as a preparation method and application of the blocking ELISA antibody detection kit. The kit is high in sensitivity, good in specificity and convenient to operate, a blocking rate (PI) method is adopted for result judgment, the accuracy is high, and compared with an imported kit, the detection coincidence rate reaches 99% or above.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a deer epidemic hemorrhagic fever virus blocking ELISA antibody detection kit, a preparation method and an application thereof. Background technique [0002] Deer epidemic hemorrhagic disease virus (EHD) is caused by deer, goat , cattle and other wild and domestic ruminant species of insect-borne infectious diseases. EHD is mainly distributed in tropical, subtropical and temperate regions, but with the gradual warming of the global climate, the range of activities of its vector, the female Culicoides spp., continues to expand, and the corresponding expansion of the disease's impact range gradually shows a trend of global distribution. . For this reason, the World Organization for Animal Health (OIE) listed it as a legally notifiable animal disease. EHD mainly affects a variety of wild and domestic ruminants such as deer, goats, and cattle, and its outb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/535G01N33/569G01N33/577
CPCG01N33/535G01N33/56983G01N33/577
Inventor 黄超华花群义曹琛福史卫军吴江林彦星林永涛翁巧玉曾少灵杨俊兴
Owner SHENZHEN CUSTOMS ANIMAL & PLANT INSPECTION & QUARANTINE TECH CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com