Porcine encephalomyocarditis indirect ELISA diagnosis kit and preparation method thereof

A diagnostic kit and myocarditis technology, applied in the field of porcine encephalomyocarditis indirect ELISA diagnostic kit and its preparation, can solve the problems of low sensitivity and specificity, high price, cumbersome operation, etc., and achieve easy purification, low cost, highly specific effect

Pending Publication Date: 2021-06-15
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have the disadvantages of cumbersome operation, high price, low sensitivity and specificity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine encephalomyocarditis indirect ELISA diagnosis kit and preparation method thereof
  • Porcine encephalomyocarditis indirect ELISA diagnosis kit and preparation method thereof
  • Porcine encephalomyocarditis indirect ELISA diagnosis kit and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 Porcine encephalomyocarditis indirect ELISA diagnostic kit

[0038] This embodiment provides a preparation method of an indirect ELISA diagnostic kit for porcine encephalomyocarditis and the specificity experimental results of the ELISA diagnostic kit.

[0039] 1. Cloning of encephalomyocarditis virus 2A gene and construction of prokaryotic expression vector

[0040] Refer to JQ864080 in GenBank to design specific primers for the 2A gene fragment,

[0041] Upstream primer: CGGGATCCAGTCCAAATGCCCTAGACAT (SEQ ID NO.1);

[0042] Downstream primer: CGCTCGAGttaTTGGGTCTGGAAAACCTGTT (SEQ ID NO.2);

[0043] A 2A-specific target gene (as shown in SEQ ID NO.3) with a size of 471bp was obtained by PCR amplification,

[0044]AGTCCAAATGCCCTAGACATTTCAAGAACATACCCCACGTTACATGTTCTCATTCAATTCAACCATAGAGGTTTGGAGGTTAGATTGTTTAGACATGGACAATTTTGGGCTGAAACACGTGCGGACGTGATTCTGAGATCGAAGACCAAACAGGTCTCTTTCCTGAGCAACGGGAACTACCCGTCAATGGACTCTAGAGCTCCCTGGAATCCTTGGAAGAATACCTACCAGGCGGTTCTAAGAGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a porcine encephalomyocarditis indirect ELISA diagnosis kit and a preparation method thereof. According to the kit disclosed by the invention, a porcine encephalomyocarditis virus 2A purified protein is used as a coating antigen on an ELISA antibody detection plate. The invention discloses a method for preparing and purifying a 2A protein. PCR amplification is carried out by using a specific primer by using genome DNA of a porcine an encephalomyocarditis virus HB10 strain as a template, enzyme digestion is carried out on an amplification product to construct a prokaryotic expression vector pET28a-2A, and induced expression is carried out on the 2A protein. An ELISA diagnosis method is high in specificity and stable and reliable in result, the porcine encephalomyocarditis virus antibody can be specifically detected, and the ELISA diagnosis method is completely suitable for diagnosis after porcine encephalomyocarditis virus infection.

Description

technical field [0001] The invention relates to the field of ELISA diagnostic kits, in particular to an indirect ELISA diagnostic kit for porcine encephalomyocarditis and a preparation method thereof. Background technique [0002] Encephalomyocarditis virus (EMCV) is a non-enveloped single-stranded small RNA virus. Although the virus has only one serotype, it has a wide range of hosts and can cause acute infectious diseases characterized by encephalitis and myocarditis in certain mammals, rodents and even humans. Among them, pigs are the most susceptible animals, which can cause acute fatal encephalitis, myocarditis or pericardial inflammation in piglets, and reproductive disorders such as abortion, stillbirth, weak fetus, and mummified fetus in pregnant sows, which bring serious problems to the pig industry. Severe economic loss; separation has also been reported in dogs and other animals. Since EMCV is an important zoonotic pathogen, and pigs are an important source of h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/58G01N33/543C12N15/70C12N15/41C07K14/085
CPCG01N33/56983G01N33/581G01N33/54306C07K14/005C12N15/70C12N2770/32222G01N2333/085
Inventor 崔尚金梁瑞英梁琳韩若婵秦彤
Owner INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap