Single-domain antibody specifically bound with insect BBMV, recombinant antibody, coding gene, preparation method and application
A single-domain antibody and recombinant antibody technology, applied in the field of genetic engineering and pest control, to achieve the effect of small molecular weight, delayed evolution, and improved control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0036] In the present invention, the recombinant antibody is preferably produced through prokaryotic expression. In the present invention, the specific preparation method preferably includes the following steps: cloning the gene encoding the recombinant antibody into an expression vector to obtain a recombinant vector, then transferring the recombinant vector into a host bacterium to obtain a recombinant strain, and inducing the The recombinant antibody is obtained by expressing the recombinant strain.
[0037] In the present invention, the expression vector is preferably pET-26b(+) vector; the host bacteria is preferably E.coliBL21(DE3). In the present invention, the steps of synthesizing the gene encoding the recombinant antibody, preparing the recombinant vector and transferring the recombinant vector into host cells are preferably entrusted to a biological company. In the present invention, after the recombinant strain is obtained, sequencing verification is preferably pe...
Embodiment 1
[0043] The human single-domain antibody library in the form of TG1 host bacteria purchased from the British Source BioScience company was rescued into a phage display antibody library using KM13 assisted phage (see the literature (Selection of human antibody fragments by phage display, NATURE PROTOCOLS|VOL.2NO. 11|200, doi: 10.1038 / nprot.2007.448) were carried out); the phage display library was used for targeted screening of Plutella xylostella BBMV.
[0044] The preparation process of Plutella xylostella BBMV is as follows: the larvae of Plutella xylostella xylostella on the second day of the 4th instar were dissected, the dissected midgut tissue was cleaned with 0.15M sodium chloride, and then placed in an EP tube placed on ice. Good samples were placed in a -80°C refrigerator for later use. BBMV is obtained by the Mg-EGTA sedimentation method, and the specific operation steps can be found in references: Wolfersberger M, Luethy P, Maurer A, et al. Preparation and partial ch...
Embodiment 2
[0050] Bispecific single chain antibody 4C1V H -2D3V L Prokaryotic expression of (recombinant antibody)
[0051] 2D3 is a monoclonal antibody that can broadly recognize Cry1A toxoid (see references for details: Construction, Expression, and Identification of Double Light Chain (V L -V L ) Antibody from a Unique Bt Cry1-Specific Monoclonal Antibody, Food Anal. Methods (2020) 13:1570–1582, https: / / doi.org / 10.1007 / s12161-020-01754-y), the light chain of 2D3 can variable region V L The sequence and the sequence of 4C1 were connected by a 45bp linker, and spliced to obtain a single-chain antibody 4C1V with a size of 786bp H -2D3V L . The nucleotide sequence of the linker is as follows: GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG (SEQ ID No. 7).
[0052] The corresponding amino acid sequence is as follows: GGGGSGGGGSGGGGS (SEQ ID No. 4).
[0053] scFv 4C1V H -2D3V L的核苷酸测序结果如下:CAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGCGTCTCTCCTGTGCAGCCTCCGGATATATCTTTAGCTATT...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com