Construction method of inducible endogenous CRISPR-Cas system and application of inducible endogenous CRISPR-Cas system in simultaneous editing of multiple genes

A construction method, an inducible technology, applied in other methods of inserting foreign genetic materials, genetic engineering, biochemical equipment and methods, etc., can solve time-consuming and labor-intensive problems that cannot meet the requirements of archaeal model organisms for chassis cell efficiency, archaea Long bacterial growth cycle and other problems, to achieve the effect of wide host range, high gene editing efficiency, and time saving

Active Publication Date: 2021-05-04
SHANDONG UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the long growth cycle of archaea, the current method based on the use of endogenous CRISPR-Cas system for single gene editing can no longer meet the efficiency requirements of the current construction of archaeal model organism chassis cells
For the requirement of gene editing at multiple sites, it is undoubtedly very time-consuming and labor-intensive to edit individual genes one by one

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of inducible endogenous CRISPR-Cas system and application of inducible endogenous CRISPR-Cas system in simultaneous editing of multiple genes
  • Construction method of inducible endogenous CRISPR-Cas system and application of inducible endogenous CRISPR-Cas system in simultaneous editing of multiple genes
  • Construction method of inducible endogenous CRISPR-Cas system and application of inducible endogenous CRISPR-Cas system in simultaneous editing of multiple genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Construction of strains containing inducible endogenous CRISPR-Cas system and deletion of CRISPR array

[0060] In this example, the construction of a Sulfolobus Icelandicum Rey15A mutant strain containing an inducible endogenous I-A CRISPR-Cas system is illustrated as an example:

[0061] 1. Construction of Single Editing Plasmids

[0062] (1) The gene cluster of the I-A CRISPR-Cas system on the Rey15A genome of Sulfolobus Icelandicus contains csa5, cas7, cas5, cas3, 'cas3, 'cas8 and cas6 genes, and the promoter of the gene cluster is in the upstream region of the csa5 gene. There is also a spacer-acquired gene cluster (Cascis) and two CRISPR clusters (C RISPR array1 and CRISPR array2) upstream of the gene cluster. In order to replace the self-promoter of the I-A CRISPR-Cas system gene cluster with an arabinose-inducible promoter, the sequence "T GGGCTGCTATAGAAGCTATCTTCAGAAAGGCAAATAAGG" in the csa1 gene upstream of the I-A gene cluster was selected as protospacer, wit...

Embodiment 2

[0079] A method for utilizing an inducible endogenous CRISPR-Cas system to realize simultaneous editing of multiple genes on a prokaryotic genome, comprising the following steps:

[0080] This example utilizes Sulfolobus Icelandicus P 50 IA, take the knockout of the SiRe_2599 and SiRe_0020 double genes on its genome as an example to illustrate:

[0081] 1. Construction of Editing Plasmids

[0082] (1) SiRe_2599 on the S. islandicus REY15A genome selects a total of 40 bases from +633 to +683 as protospacer1 (S1) and SiRe_0020 selects a total of 40 bases from +214 to +264 as protospacer2 (S2) , the 5' ends of the above S1 and S2 sequences are adjacent to CCN-PAM (protospacer Adjacent Motif), so they can be targeted by the host endogenous I-A type CRIISPR-Cas system. Four primers (2S-S1-2599-F / 2S-S1-2599-R / 2S-S2-0020-F / 2S-S2-0020-R) were designed based on the above two protospacer (Table 1), and the four primers were added (20:1:1:20) ratio to obtain CRISPR cluster fragments b...

Embodiment 3

[0090] A method for utilizing an inducible endogenous CRISPR-Cas system to realize simultaneous editing of multiple genes on a prokaryotic genome, comprising the following steps:

[0091] This example utilizes Sulfolobus Icelandicus P 50 IA, as an example to illustrate the knockout of the SiRe_1994 and SiRe_0811 double genes on its gene:

[0092] 1. Construction of Editing Plasmids

[0093] (1) SiRe_1994 on the genome of Sulfolobus Iceland REY15A selects a total of 40 bases from +160 to +200 as protospacer3 (S3) and SiRe_0811 selects a total of 40 bases from +408 to +448 as protospacer4 (S4), the above S3 Both the 5' end of the sequence and S4 sequence are adjacent to CCN-PAM, so they can be targeted by the host endogenous type I-A CRIISPR-Cas system. Four primers (2S-S3-1994-F / 2S-S3-1994-R / 2S-S4-0811-F / 2S-S4-0811-R) were designed based on the above two protospacers (Table 1), and four primers were added ( 20:1:1:20) to obtain CRISPR cluster fragments by PCR.

[0094] (2) Th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a construction method of an inducible endogenous CRISPR-Cas system and application of the inducible endogenous CRISPR-Cas system in simultaneous editing of multiple genes, and belongs to the technical field of genomics, genetic engineering and biology. According to the inducible endogenous CRISPR-Cas system disclosed by the invention, only one plasmid containing a CRISPR cluster containing a plurality of spacers and a plurality of donor DNA fragments and a strain with the inducible endogenous CRISPR-Cas system need to be constructed. A large number of CRISPR-Cas effect compounds generated during induction are utilized to complete simultaneous targeted cutting of a plurality of genes and homologous recombination repair of DNA of a plurality of donors, so that simultaneous editing of the plurality of genes is realized. According to the method, the gene editing efficiency is high, the multi-gene editing of the prokaryote can be completed at one time or by fewer times, the required time, energy and cost are greatly saved, and the applicable host range is wide, so that the method has good practical application value.

Description

technical field [0001] The invention belongs to the fields of genomics, genetic engineering and biotechnology, and in particular relates to a construction method of an inducible endogenous CRISPR-Cas system and its application in simultaneous editing of multiple genes. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] The CRISPR-Cas system is an acquired immune system that widely exists in prokaryotes, and about 90% of archaea and 40% of bacteria contain this immune system (Grissa et al 2007). Its immune process is mainly divided into three stages: adaptation, crRNA processing and interference, so as to help the host complete memory, target and crack foreign invading nuclei...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N9/22C12N15/63C12N15/90
CPCC12N15/113C12N9/22C12N15/63C12N15/902C12N2310/20
Inventor 佘群新赵鹏鹏冯明霞冯旭于振霄
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap