Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A genetic drug for affective disorders in children

A technology for drugs and uses, applied in drug combinations, pharmaceutical formulations, medical preparations containing active ingredients, etc., can solve problems such as increasing the difficulty of depression research, unclear boundaries, etc., to achieve the treatment of depression and emotional disorders, inhibit nerve Cell damage and inhibition of neuronal apoptosis

Active Publication Date: 2022-05-20
青岛思拓新源细胞医学有限公司
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Depression is difficult to study because it often presents with poorly defined phenotypes and is therefore prone to great intertwining with other disorders

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A genetic drug for affective disorders in children
  • A genetic drug for affective disorders in children
  • A genetic drug for affective disorders in children

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Preparation and inspection of LOC107985688 siRNA

[0025] 1. Design 3 siRNAs to knock down LOC107985688

[0026] The sequences of the 3 siRNAs are as follows

[0027] The sense strand sequence of si-LOC107985688-1 is GCUGGACAAUGCAAAUGAACU (SEQ ID NO.2)

[0028] The sequence of the antisense strand of si-LOC107985688-1 is UUCAUUUGCAUUGUCCAGCUU (SEQ ID NO.3)

[0029] The sense strand sequence of si-LOC107985688-2 is CACAGAAGAUCGAAGUGUACA (SEQ ID NO.4)

[0030] The sequence of the antisense strand of si-LOC107985688-2 is UACACUUCGAUCUUCUGUGAU (SEQ ID NO.5)

[0031] The sense strand sequence of si-LOC107985688-3 is ACGACUACGUGUAAAAGUAAUG (SEQ ID NO.6)

[0032] The sequence of the antisense strand of si-LOC107985688-3 is UUACUUUACACGUAGUCGUUG (SEQ ID NO.7)

[0033] 2. Detection of the inhibitory effect of 3 siRNAs

[0034] (1) SH-SY5Y cells were seeded in cell culture plates, transfected with si-NC, si-LOC107985688-1, si-LOC107985688-2 and si-LOC107985688-3, with 3 rep...

Embodiment 2

[0047] Protective effect of inhibiting LOC107985688 against H2O2-induced oxidative damage

[0048] (1) 5000 SH-SY5Y cells were seeded in 96-well plates and divided into group A (transfected with si-NC but not treated with H2O2), group B (transfected with si-NC and added 250 μmol / mL of H2O2), group C (transfected with si-LOC107985688-3 and added 250 μmol / mL of H2O2 after 24 hours of transfection), each group set up 3 replicate wells;

[0049] (2) After H2O2 treatment, use MTT to detect OD value and calculate cell viability.

[0050]Experimental results such as figure 2 As shown, H202 treatment for 24 hours can significantly reduce the cell viability of SH-SY5Y cells (cell viability of group B is 67.97±1.894), while the cell viability of group C is significantly higher than that of group B (cell viability of group C is 80.87±2.206) , indicating that transfection of si-LOC107985688-3 in SH-SY5Y cells can partially reverse the decrease in cell viability caused by H202.

Embodiment 3

[0052] Inhibit the regulation of Nrf2 protein by LOC107985688

[0053] Nrf2 (nuclear factor E2-related factor 2) is a key regulatory factor in the cellular antioxidant system and can regulate the expression of various antioxidant genes in cells. Therefore, the present invention detects whether inhibiting LOC107985688 can regulate Nrf2 protein.

[0054] (1) SH-SY5Y cells were seeded in 6-well cell culture plates, group A (transfected with si-NC but not treated with H2O2), group B (transfected with si-NC and added 250 μmol / mL of H2O2), group C (transfected with si-LOC107985688-3 and added 250 μmol / mL of H2O2 24 hours after transfection), each group was set with 3 replicate wells;

[0055] (2) After 24 hours of treatment, remove the medium, wash the cells twice with PBS, add protein lysate, scrape off the cells with a cell scraper, and transfer the cells to a 1.5ml EP tube with a pipette;

[0056] (3) On ice, lyse for 30 minutes, and vortex every 10 minutes with a vortexer;

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of children's affective disorders, in particular to a gene medicine for treating depression. The present invention provides a LOC107985688 siRNA that effectively inhibits the expression of LOC107985688. The LOC107985688 siRNA provided by the present invention can effectively inhibit nerve cell damage and nerve cell apoptosis caused by H2O2, so it can be used to prepare gene medicine for depression. The medicine prepared in the present invention can be prepared as aerosol medicine, injection medicine or oral medicine.

Description

technical field [0001] The invention belongs to the technical field of children's affective disorders, in particular to a gene medicine for children's affective disorders. Background technique [0002] Affective disorders in children include disorders such as depression and autism. At present, the incidence of depression in children and adolescents in my country is increasing year by year, and depression has become a major disease that threatens the healthy growth of children and adolescents. Depression is a serious mental illness. The main clinical symptoms of depression patients are significant and persistent depression, loss of interest, slow thinking, pessimism and hopelessness, and lack of initiative. Consistent with a variety of physical discomfort, severe patients will appear suicidal thoughts and behaviors. According to relevant statistics, there are currently about 350 million people in the world suffering from depression, and depression has become the second larg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K45/00A61K31/713A61P25/24A61P25/00
CPCA61K45/00A61K31/713A61P25/24A61P25/00
Inventor 曹爱华
Owner 青岛思拓新源细胞医学有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More