Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and probe sequence for klebsiella pneumoniae fluorescence RAA detection and application

A technology of Klebsiella pneumoniae and probe sequence, applied in the direction of microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc. Focus on issues such as sequence to achieve the effect of controlling the epidemic and gaining time, strong specificity, and ensuring reliability

Inactive Publication Date: 2021-02-26
宁波国际旅行卫生保健中心
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, RAA technology can also complete multiple primer amplification. With the fluorescence instrument, a set of RAA multiple fluorescence real-time detection system can be formed, that is, different color fluorescent labels can be used to detect different target genes in the same reaction. This is another Incomparable to constant temperature nucleic acid amplification technology or nested PCR technology
At present, there is no disclosure of primers and probe sequences and kits for the detection of Klebsiella pneumoniae fluorescent RAA at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for klebsiella pneumoniae fluorescence RAA detection and application
  • Primer and probe sequence for klebsiella pneumoniae fluorescence RAA detection and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] For the specific conserved region of Klebsiella pneumoniae as the target region, specific primers and fluorescent RAA probes were designed: the forward primer was 5'-TGGCCGGTTGCGTACAGGTTGATCGTTATGA-3';

[0023] Reverse primer: 5'-AGGGAAGCGGTCACGTTGTAGATCTCACTGTCAC-3'; Oligonucleotide probe:

[0024] 5'- CAAACGAAAGGGCCGCAGAGCGCGATGA (FAM-dT)G(THF)G(BHQ-dT) CCTGACGCCATTG -3';

[0025] Among them: FAM: 6-carboxyfluorescein; THF: tetrahydrofuran; BHQ: black hole quencher; phosphate: phosphorylation at 3' to stop extension.

Embodiment 2

[0027] A fluorescent RAA method for detecting Klebsiella pneumoniae, comprising the following steps:

[0028] 1. Extraction of sample DNA: Klebsiella pneumoniae standard strains and isolated strains were expanded in LB medium for 18-24 hours, and DNA was extracted using DNA extraction reagent (cador Pathogen 96QIAcube HT kit, Kaijie Company, Germany). Aliquot and store at -80°C;

[0029] 2. Use the DNA of the sample to be detected as a template, add RAA reaction solution, enzyme mixture, etc. to form an RAA reaction system, and perform an amplification reaction. The reaction system is as follows: 25 μl RAA reaction buffer; forward primer, reverse primer (10 μM ) 2.1 μl each; 0.6 μl probe (10 μM); 2 μl DNA template; add 15.5 μl double distilled water to 47.5 μl, mix well, and then add to dry powder (containing recombinase, single-strand binding protein, DNA polymerase, reaction buffer solution, dNTP, etc., in the reaction tube of RAA Nucleic Acid Amplification Kit (Fluorescenc...

Embodiment 3

[0037] Standard strains, clinical isolates detection experiment

[0038]This experiment verifies whether this detection method can detect bacterial standard strains, and adopts the above-mentioned embodiment 2 method to detect the Klebsiella pneumoniae standard strain ATCC 7000603 that is in the logarithmic growth phase through LB medium expansion culture, and concentration is about 5×10 8 CFU / ml, experimental results refer to figure 1

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and probe sequence for klebsiella pneumoniae fluorescence RAA detection. a specific primer and a fluorescence RAA probe are designed by taking a specific conserved region of klebsiella pneumoniae as a target region, a totally-enclosed reaction is carried out, fluorescence data is monitored in real time, subsequent treatment is not needed, pollution is avoided, and the reliability of a detection result is ensured; the primer and the probe do not depend on expensive instruments such as PCR, detection can even be performed at the normal temperature of 37 DEG C, a diagnosis result can be obtained within 20 minutes, the detection time is greatly shortened, single-tube on-site and rapid detection can be achieved, and the primer and the probe have the advantages ofstrong specificity, high sensitivity and high detection speed.

Description

technical field [0001] The invention belongs to the field of in vitro nucleic acid detection, in particular to a primer and probe sequence for the detection of Klebsiella pneumoniae fluorescent RAA and an application thereof. Background technique [0002] Klebsiella pneumoniae is the most important type of bacteria in the Enterobacteriaceae Klebsiella genus (commonly known as Klebsiella pneumoniae), and the diseases caused by it account for more than 95% of Klebsiella infections. and intestinal tract, when the body's resistance is reduced, it enters the lungs through the respiratory tract and causes confluent consolidation of the lobe or lobule, and the upper lobe is more common. Klebsiella pneumoniae is a Gram-negative bacillus with a size of 0.5-0.8×1-2um, arranged alone, in pairs or in short chains. No spores, no flagella. There are thicker capsules, most of which have pili. Nutritional requirements are not high, and large off-white mucus colonies are formed on ordinar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/22
CPCC12Q1/6844C12Q1/689C12Q2521/507C12Q2563/107C12Q2522/101
Inventor 周冬根罗洁应清界俞雪钧
Owner 宁波国际旅行卫生保健中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com