Real-time fluorescent pcr detection method and detection kit of the yushu non-hooked bat moth
A technology of real-time fluorescence and detection methods, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve problems such as false positive amplification and difficulty in locating specific fragments of A. yushu. Achieve the effect of high accuracy, accurate identification results and shortened detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] 1. Design Primers and Probes
[0050] According to the sequence of some genes in the mtDNA (mitochondrial DNA) of A. yushu, the following primers YSF1 / YSR1 and probe YS-P1 were designed (primers and probes were synthesized by Shanghai Jikang Company):
[0051] The sequence of the primer is:
[0052] Upstream primer YSF1: 5'-CCTGTTCCTGCCCCGTTT-3', as shown in SEQ ID NO: 1;
[0053] Downstream primer YSR1: 5'- AAGATTTTGATTATTACCCCCATCAT -3', as shown in SEQ ID NO: 2;
[0054] The sequence of the probe YS-P1 is:
[0055] The probe YS-P1: 5'- CTACAATTCTCCTAGAAATT -3' of the Yushu basilisk moth probe, as shown in SEQ ID NO: 3, the fluorescent group is connected to the 5' end of the probe, and the quencher group is connected to the 3' end;
[0056] The detection principle of the above primers and probes is as follows: figure 1 shown. Probe YS-P1 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the prob...
Embodiment 2
[0065] 1. Designing Primers and Probes
[0066] Design the following specific primers YSF2 / YSR2 and probe YS-P2 (primers and probes disclosed in the present invention, primers and probes are provided by Shanghai Jikang according to the sequence of some genes in the mtDNA (mitochondrial DNA) of A. company synthesis):
[0067]Upstream primer YSF2: 5'-GCAGGGTCGAAAAATGAAGTATTT-3', sequence shown in SEQ ID NO: 4;
[0068] Downstream primer YSR 2: 5'- TGTGTGAAGGGTTGTAATTACTGCAT -3', the sequence shown in SEQ ID NO: 5;
[0069] The probe YS-P2 of the eucalyptus moth probe YS-P2: 5'- TAGCTCCTGCTAATACAG -3', the sequence shown in SEQ ID NO: 6;
[0070] The detection principle of the above primers and probes is as follows: image 3 shown. Probe YS-P2 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; during P...
Embodiment 3
[0076] Example 3 Verification and detection sensitivity test of the specific primer YSF3 / YSR3 and probe YS-P3 of the eucalyptus moth
[0077] 1. Design the following specific primers YSF3 / YSR3 and probe YS-P3 (primers and probes disclosed in the present invention, primers and probes are provided by Shanghai Kekon Synthetic):
[0078] Upstream primer YSF3: 5'-GTTGCAAGAATTGCATCAAATG-3', sequence shown in SEQ ID NO: 7;
[0079] Downstream primer YSR3: 5'-CAATTATGGGCCTTTACGATCT-3', sequence shown in SEQ ID NO: 8;
[0080] The probe YS-P3 of the yushu lynch moth probe YS-P3: 5'- AAATTTATAATAGCCAAAGCTATT-3', the sequence shown in SEQ ID NO: 9;
[0081] The detection principle of the above primers and probes is as follows: Figure 5 shown. Probe YS-P3 is an oligonucleotide probe with a fluorophore attached to the 5' end of the probe and a quencher at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group; duri...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com