Application of DRK protein and coding gene thereof in drought resistance of plants
A technology that encodes genes and proteins, applied in applications, plant products, genetic engineering, etc., can solve the problems of less functional research and achieve the effects of short breeding time, enhanced plant drought resistance, and improved efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1, Construction and Detection of CRISPR / Cas9 Gene Editing Vectors
[0042] In order to study the molecular mechanism of RAF-like MAPKKK family proteins in plant drought resistance, the present invention uses CRISPR / Cas9 technology to directionally mutate the DRK gene (nucleotide sequence shown in SEQ ID NO.1) from the genome of maize (Zea mays L.) , the amino acid sequence is shown in SEQ ID NO.2). First log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen the target. sequence such as figure 1 shown in figure 1 Among them, the T01 transcript is from the 1112th to the 2609th base of the 5' end, the capital letters are bolded as exons, the start codon and stop codon are in the gray box, and the underlined part is the target.
[0043] The primers used are as follows:
[0044] ID-If: GGCGCGTCATGCCCTGGAACGGG (SEQ ID NO. 3);
[0045] ID-1r: AAACCCCGTTCCAGGGCATGACG (SEQ ID NO. 4).
[0046] Carrier construction method:
[0047] (...
Embodiment 2
[0059] Example 2, Construction and Identification of DRK Gene CRISPR-Cas9 Plants
[0060] The plasmid with correct sequencing constructed in Example 1 was transformed into competent Agrobacterium strain EHA105 by heat shock method, and positive clones were identified by colony PCR. Inoculate a single colony of Agrobacterium correctly identified in 2-3 mL of liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, culture with shaking at 28 °C overnight, and transfer a large amount of liquid containing antibiotics the next day Shake culture in the medium, collect the cells after several transfers, and resuspend to OD 600 Between 0.8-1.0. After the obtained recombinant Agrobacterium suspension was used to infect the B73 maize immature embryos picked out under aseptic conditions, callus was induced to form seedlings. Sequencing found that the single base deletion mutation in this example caused a frameshift ( figure 2 ), leading to premature termination of protei...
Embodiment 3
[0061] Example 3, DRK mutant corn drought treatment phenotype detection
[0062] Add 140g of soil to each small pot, add water to the tray, put 4 seeds in each small pot, cover 50cm 3 After the soil is full of water, pour out the remaining water in the tray. After emergence, remove a seedling with uneven growth, add 1L of water in the tray, pour out the water after it is full, start the drought treatment, and observe the control and mutation Somatic plant phenotypes under drought treatment. The control and mutant plants were replicated in 3 pots each. image 3 It shows that the growth condition of DRK CRISPR / Cas9 mutant plants is better than that of the control, and the wilting degree of leaves is lower than that of the control, indicating that the mutant plants are more drought-resistant than the control.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com