Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of sodium propionate in preparation of medicine for treating bronchopulmonary dysplasia

A hypoplastic and bronchial technology, applied in the field of medicine, to broaden the field of choice, improve abnormal pulmonary angiogenesis, and improve alveolar developmental block.

Active Publication Date: 2020-09-29
JIANGNAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

No studies have reported the role of propionic acid in the preparation of anti-BPD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of sodium propionate in preparation of medicine for treating bronchopulmonary dysplasia
  • Application of sodium propionate in preparation of medicine for treating bronchopulmonary dysplasia
  • Application of sodium propionate in preparation of medicine for treating bronchopulmonary dysplasia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] The making of embodiment 1 BPD model:

[0016] Newborn 5-day-old mice were randomly divided into three groups:

[0017] (1) Saline group (Saline): normal control group, mice were intraperitoneally injected with saline every day until the end of the experiment.

[0018] (2) BPD mouse group (LPS): After a single intraperitoneal injection of lipopolysaccharide (LPS), normal saline was injected intraperitoneally every day until the end of the experiment.

[0019] (3) BPD-sodium propionate group (LPS+SP): single intraperitoneal injection of lipopolysaccharide (LPS), followed by intraperitoneal injection of SP 2 hours later, and intraperitoneal injection of SP every day until the end of the experiment.

[0020] The method of making the BPD model: the BPD model is simulated by intraperitoneally injecting lipopolysaccharide into a 5-day-old newborn mouse, which is also a currently recognized method for making BPD mice. The specific method is as follows: a single injection of ...

Embodiment 2

[0021] Example 2 RNA Extraction and Real-time PCR

[0022] RNA was extracted from lung tissue by the Trizol (Life Technologies) method, and the specific operation was performed according to the instructions. The content of RNA was detected by ultraviolet spectrophotometer, and the purity of RNA was detected according to the ratio of absorbance at 260nm and 280nm. Pure RNA should have an OD260 / OD280 ratio close to 2.0 (with a reliable range of 1.9-2.1). Take 1 μg of total RNA, add 2 μl 5×PrimeScript RT Master Mix (Takara), make up to 10 μl with deionized water for reverse transcription, and synthesize cDNA; Real-time PCR is carried out with the primers listed below and the set program.

[0023] Mouse-IL-β:

[0024] Forward CAAGGAGAACCAAGCAACGA

[0025] Reverse TTTCATTACACAGGACAGGTATAGA

[0026] Mouse-IL-6:

[0027] Forward ACTTCCATCCAGTTGCCTTCTTGG

[0028] Reverse TTAAGCCTCCGATTGTGAAGTG

[0029] Mouse-TNF-α:

[0030] Forward AGGTTTCTCTTCAAGGGACAA

[0031] Reverse GACTT...

Embodiment 3

[0053] Example 3 Lung tissue and serum superoxide dismutase (SOD) activity

[0054] Superoxide dismutase is the first antioxidant enzyme that plays a role in the active oxygen scavenging system, which can remove superoxide anion free radicals in organisms and effectively resist the damage of oxygen free radicals to the body. Superoxide dismutase assay kit (Nanjing Jiancheng Company) was used to measure the SOD activity in serum and lung tissue.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medicines, and particularly relates to an application of sodium propionate in preparation of a medicine for treating bronchopulmonary dysplasia. A new target is provided for preparing the medicine for treating the BPD, and the sodium propionate is applied to the development process of the medicine related to the BPD so as to prepare the better medicine for treating the BPD. A brand new idea is provided for the BPD treating medicine at present, the selection field of the BPD treating medicine is widened, and a new means and way are provided for treatment ofthe BPD.

Description

technical field [0001] The invention belongs to the field of medicine, and in particular relates to the application of sodium propionate in the preparation of medicines for treating bronchopulmonary dysplasia. Background technique [0002] Bronchopulmonary dysplasia (BPD) is a chronic lung disease associated with premature birth, with an incidence rate of 5%-68%. It is the most common and serious chronic respiratory disease in very premature and very low birth weight infants. The pathogenesis of BPD involves the influence of multiple factors in prenatal (maternal chorioamnionitis, preeclampsia) and postpartum (mechanical ventilation, oxygen toxicity, sepsis, etc.), and is characterized by structural abnormalities of the lungs, including alveolar simplification (less Secondary septum and alveoli) and abnormal pulmonary angiogenesis (malformed blood vessels and capillaries). [0003] Abnormal pulmonary microangiogenesis caused by chronic pulmonary inflammation and oxidative s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/19A61P11/00
CPCA61K31/19A61P11/00Y02A50/30
Inventor 陈丹庞庆丰高智琪吴亚先王莺莺
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com