Application of sodium propionate in preparation of medicine for treating bronchopulmonary dysplasia
A hypoplastic and bronchial technology, applied in the field of medicine, to broaden the field of choice, improve abnormal pulmonary angiogenesis, and improve alveolar developmental block.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] The making of embodiment 1 BPD model:
[0016] Newborn 5-day-old mice were randomly divided into three groups:
[0017] (1) Saline group (Saline): normal control group, mice were intraperitoneally injected with saline every day until the end of the experiment.
[0018] (2) BPD mouse group (LPS): After a single intraperitoneal injection of lipopolysaccharide (LPS), normal saline was injected intraperitoneally every day until the end of the experiment.
[0019] (3) BPD-sodium propionate group (LPS+SP): single intraperitoneal injection of lipopolysaccharide (LPS), followed by intraperitoneal injection of SP 2 hours later, and intraperitoneal injection of SP every day until the end of the experiment.
[0020] The method of making the BPD model: the BPD model is simulated by intraperitoneally injecting lipopolysaccharide into a 5-day-old newborn mouse, which is also a currently recognized method for making BPD mice. The specific method is as follows: a single injection of ...
Embodiment 2
[0021] Example 2 RNA Extraction and Real-time PCR
[0022] RNA was extracted from lung tissue by the Trizol (Life Technologies) method, and the specific operation was performed according to the instructions. The content of RNA was detected by ultraviolet spectrophotometer, and the purity of RNA was detected according to the ratio of absorbance at 260nm and 280nm. Pure RNA should have an OD260 / OD280 ratio close to 2.0 (with a reliable range of 1.9-2.1). Take 1 μg of total RNA, add 2 μl 5×PrimeScript RT Master Mix (Takara), make up to 10 μl with deionized water for reverse transcription, and synthesize cDNA; Real-time PCR is carried out with the primers listed below and the set program.
[0023] Mouse-IL-β:
[0024] Forward CAAGGAGAACCAAGCAACGA
[0025] Reverse TTTCATTACACAGGACAGGTATAGA
[0026] Mouse-IL-6:
[0027] Forward ACTTCCATCCAGTTGCCTTCTTGG
[0028] Reverse TTAAGCCTCCGATTGTGAAGTG
[0029] Mouse-TNF-α:
[0030] Forward AGGTTTCTCTTCAAGGGACAA
[0031] Reverse GACTT...
Embodiment 3
[0053] Example 3 Lung tissue and serum superoxide dismutase (SOD) activity
[0054] Superoxide dismutase is the first antioxidant enzyme that plays a role in the active oxygen scavenging system, which can remove superoxide anion free radicals in organisms and effectively resist the damage of oxygen free radicals to the body. Superoxide dismutase assay kit (Nanjing Jiancheng Company) was used to measure the SOD activity in serum and lung tissue.
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap