Vitreoscilla hemoglobin expression cassette suitable for bacillus and application thereof
A technology of hemoglobin and hyaline bacteria, applied in the direction of hemoglobin/myoglobin, application, bacitracin, etc., can solve the problems of not listing the types of penetrating peptides, no similarity of Halomonas and Bacillus genome information, and physiological morphology Large differences and other problems, to achieve the effect of improving expression efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Construction of Vitella hyaline hemoglobin cassettes containing different Bacillus penetrating peptides:
[0024] 1. Connect the four sections of P43 promoter, SPywbN signal peptide, vhb gene and TamyL terminator to construct the P43-SPywbN-vhb-TamyL expression cassette, whose sequence is shown in SEQ ID NO.1.
[0025] 2. Using the pHY300PLK plasmid as a template, the pHY300PLK vector was amplified by PCR, and the primers were 300-T5-F: gaattcctgttataaaaaaaggatc and 300-T5-R: tctagaagcttgggcaaagcgtttt.
[0026] 3. Measure the concentration of the pHY300PLK vector and the target gene fragment, calculate the amount of the vector and the fragment used, and prepare the reaction system on ice (using the ClonExpress II recombinant cloning kit, purchased from Nanjing Novizan Biotechnology Co., Ltd.), 37°C Immediately after the recombination reaction for 30 min, place it on ice to cool; Ca 2+ The transformation method transforms the recombinant product into Escherichia coli DH...
Embodiment 2
[0032] Screening of Vitella hyaline hemoglobin cassettes suitable for Bacillus:
[0033] The Bacillus subtilis hemoglobin expression strain obtained in Example 1 was subjected to a poly-γ-glutamic acid fermentation experiment. The specific steps of seed culture: inoculate the Bacillus subtilis strains obtained in Example 1 into the LB liquid medium added with 1‰ (v / v) Tet antibiotics respectively, and culture in a shaker at 180~300r / min 37°C for 12h; then The activated bacterial solution was inoculated in 50 mL of LB liquid medium with 1% (v / v) inoculum amount, and 1‰ (v / v) Tet antibiotic was added at the same time, and cultured at 230 r / min 37°C for 12 hours to obtain the seed culture required for fermentation liquid.
[0034] The formula of poly-γ-glutamic acid fermentation medium is: 80g / L glucose, 30g / L sodium glutamate, 10g / L sodium citrate, 10g / L sodium nitrate, 8g / L ammonium chloride, 1g / L hydrogen phosphate Dipotassium, 1g / L Zinc Sulfate Heptahydrate, 1g / L Calcium Ch...
Embodiment 3
[0041] Application of P43-SPywbN-vhb-TamyL expression cassette in improving the yield of Bacillus subtilis poly-γ-glutamic acid fermentation:
[0042] In this embodiment, for different poly-γ-glutamic acid fermentation medium formulations, investigate and understand the ability of Bacillus subtilis BS168 / pH Y-P43-SPywbN-vhb-TamyL to produce poly-γ-glutamic acid (also here Inoculate Bacillus subtilis BS168 / pHY-P43-vhb-TamyL in 21 kinds of culture medium as contrast), 21 groups of culture medium formulations are specifically as shown in Table 2:
[0043] Table 2 Different formulations of poly-γ-glutamic acid fermentation medium
[0044]
[0045]
[0046] The concrete steps of seed culture: the Bacillus subtilis bacterial strain BS168 / pHY-P43-SPywbN-vhb-TamyL that embodiment 1 obtains and control bacterial strain Bacillus subtilis BS168 / pHY-P43-vhb-TamyL are inoculated to add 1‰ (v / v) In the LB liquid medium of Tet antibiotics, 180 ~ 300r / min 37 ℃ shaker culture for 12h; ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap