Vitreoscilla hemoglobin expression cassette suitable for bacillus and application thereof

A technology of hemoglobin and hyaline bacteria, applied in the direction of hemoglobin/myoglobin, application, bacitracin, etc., can solve the problems of not listing the types of penetrating peptides, no similarity of Halomonas and Bacillus genome information, and physiological morphology Large differences and other problems, to achieve the effect of improving expression efficiency

Active Publication Date: 2020-08-18
HUBEI UNIV
View PDF12 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the article does not list specific types of penetrating peptides
In addition, there is no similarity in the genome information of Halomonas and Bacillus, and the physiological morphology is also quite different
Therefore, the high-efficiency expression of C. hyaline hemoglobin in Bacillus and the high-efficiency synthesis of metabolites based on the high-efficiency expression of C. hyaline hemoglobin cannot be carried out based on previous results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vitreoscilla hemoglobin expression cassette suitable for bacillus and application thereof
  • Vitreoscilla hemoglobin expression cassette suitable for bacillus and application thereof
  • Vitreoscilla hemoglobin expression cassette suitable for bacillus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Construction of Vitella hyaline hemoglobin cassettes containing different Bacillus penetrating peptides:

[0024] 1. Connect the four sections of P43 promoter, SPywbN signal peptide, vhb gene and TamyL terminator to construct the P43-SPywbN-vhb-TamyL expression cassette, whose sequence is shown in SEQ ID NO.1.

[0025] 2. Using the pHY300PLK plasmid as a template, the pHY300PLK vector was amplified by PCR, and the primers were 300-T5-F: gaattcctgttataaaaaaaggatc and 300-T5-R: tctagaagcttgggcaaagcgtttt.

[0026] 3. Measure the concentration of the pHY300PLK vector and the target gene fragment, calculate the amount of the vector and the fragment used, and prepare the reaction system on ice (using the ClonExpress II recombinant cloning kit, purchased from Nanjing Novizan Biotechnology Co., Ltd.), 37°C Immediately after the recombination reaction for 30 min, place it on ice to cool; Ca 2+ The transformation method transforms the recombinant product into Escherichia coli DH...

Embodiment 2

[0032] Screening of Vitella hyaline hemoglobin cassettes suitable for Bacillus:

[0033] The Bacillus subtilis hemoglobin expression strain obtained in Example 1 was subjected to a poly-γ-glutamic acid fermentation experiment. The specific steps of seed culture: inoculate the Bacillus subtilis strains obtained in Example 1 into the LB liquid medium added with 1‰ (v / v) Tet antibiotics respectively, and culture in a shaker at 180~300r / min 37°C for 12h; then The activated bacterial solution was inoculated in 50 mL of LB liquid medium with 1% (v / v) inoculum amount, and 1‰ (v / v) Tet antibiotic was added at the same time, and cultured at 230 r / min 37°C for 12 hours to obtain the seed culture required for fermentation liquid.

[0034] The formula of poly-γ-glutamic acid fermentation medium is: 80g / L glucose, 30g / L sodium glutamate, 10g / L sodium citrate, 10g / L sodium nitrate, 8g / L ammonium chloride, 1g / L hydrogen phosphate Dipotassium, 1g / L Zinc Sulfate Heptahydrate, 1g / L Calcium Ch...

Embodiment 3

[0041] Application of P43-SPywbN-vhb-TamyL expression cassette in improving the yield of Bacillus subtilis poly-γ-glutamic acid fermentation:

[0042] In this embodiment, for different poly-γ-glutamic acid fermentation medium formulations, investigate and understand the ability of Bacillus subtilis BS168 / pH Y-P43-SPywbN-vhb-TamyL to produce poly-γ-glutamic acid (also here Inoculate Bacillus subtilis BS168 / pHY-P43-vhb-TamyL in 21 kinds of culture medium as contrast), 21 groups of culture medium formulations are specifically as shown in Table 2:

[0043] Table 2 Different formulations of poly-γ-glutamic acid fermentation medium

[0044]

[0045]

[0046] The concrete steps of seed culture: the Bacillus subtilis bacterial strain BS168 / pHY-P43-SPywbN-vhb-TamyL that embodiment 1 obtains and control bacterial strain Bacillus subtilis BS168 / pHY-P43-vhb-TamyL are inoculated to add 1‰ (v / v) In the LB liquid medium of Tet antibiotics, 180 ~ 300r / min 37 ℃ shaker culture for 12h; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of biotechnology and fermentation engineering. The invention provides a vitreoscilla hemoglobin expression cassette suitable for bacillus and application. Vitreoscilla hemoglobin VHb is connected with a signal peptide SPywbN of YwbN in bacillus subtilis, a bacillus subtilis promoter P43 and an amylase terminator TamyL in bacillus licheniformis to form a VHb protein expression cassette P43-SPywbN-vhb-TamyL. The expression cassette is applied to three types of bacillus subtilis (bacillus subtilis 168, bacillus amyloliquefaciens LX-12 and bacillus licheniformisDW2); compared with a conventional strain for independently and intensively expressing VHb, the yield of poly gamma-glutamic acid, iturin A and bacitracin is increased by 21.85%, 18.77% and 23.40% respectively, and theoretical guidance is provided for efficient expression and wide application of vitreoscilla hemoglobin VHb in bacillus.

Description

technical field [0001] The invention belongs to the field of biotechnology and fermentation engineering, and in particular relates to a hemoglobin expression cassette suitable for bacillus and its application. Background technique [0002] Vitreoscilla hemoglobin (VHb) is the first hemoglobin found in bacteria, which is derived from a Gram-negative bacterium, Vitreoscilla hemoglobin. The VHb in the natural state exists in the form of a homodimer, and the two subunits form 6 α-helices (A, B, E, F, G, H) from 146 amino acid residues, with a relative molecular weight of 15775, and each Contains a molecule of b-type hemoglobin. Under hypoxic conditions, VHb can combine with oxygen to undergo a conformational change, and can dissociate with oxygen, transfer oxygen to the respiratory chain, and regulate the activity of oxidase at the end of the respiratory chain. At present, VHb has been successfully expressed in a variety of host cells (Escherichia coli, Pseudomonas, tobacco, r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/75C12N15/31C12P13/02C12P21/04C12R1/125C12R1/07C12R1/10
CPCC07K7/56C07K7/58C07K14/805C12N15/75C12P13/02
Inventor 陈守文张清蔡冬波陈耀中杨帆马昕
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products