Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel application of pig GADD45a gene and construction and application of high-expression cell line

A high-expression, cell-line technology, applied in genetically modified cells, epidermal cells/skin cells, cells modified by introducing foreign genetic material, etc., can solve the problems of few research reports on porcine GADD45a.

Active Publication Date: 2020-05-29
ZHEJIANG UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few reports on porcine GADD45a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel application of pig GADD45a gene and construction and application of high-expression cell line
  • Novel application of pig GADD45a gene and construction and application of high-expression cell line
  • Novel application of pig GADD45a gene and construction and application of high-expression cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0040] The present invention will be further elaborated below in conjunction with the accompanying drawings and embodiments.

[0041] (1) Construction and identification of porcine GADD45a gene lentiviral expression vector

[0042] 1. Design of full-length primers for porcine GADD45a gene

[0043] Primers for amplifying the 499bp sequence were designed using oligo 6.0 primer software. In order to facilitate cloning with the pLEX-MCS vector, Xho I and BamH I restriction sites were added to both ends of the primers. The primer sequences are as follows:

[0044] GADD45a-F: 5'-GAG GATCC ACTAGT ATG ACTTTGGAGGAATTCTCGGCT -3’ (Italics are Bam H I restriction site, the underline is the start codon);

[0045] GADD45a-R: 5’-CGA GCGGCCGC TCAAGCGTAGTCTGGGACGGTATGGGTA CCGTCCGTTCAGGAAGA-3' (Italics are Not I restriction sites, double underlines are stop codons, and underlines are HA tag sequences).

[0046] 2. Extraction of total RNA

[0047] The piglets were taken out one w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses novel application of a pig GADD45a gene and construction and application of a high-expression cell line. A method comprises the following steps: according to a full-length geneof a pig GADD45a gene and a vector pLEX-MCS, designing and synthesizing an amplification primer which comprises digestion loci and the full-length gene of GADD45a; performing amplification from piglet fat tissue so as to obtain the full-length gene of the GADD45a gene, performing recycling and digestion, connecting the gene with pLEX-MCS after digestion, constructing a pLEX-MCS-GADD45a lentivirusplasmid, performing monoclonal sequencing identification and verification, performing cotransfection on the pLEX-MCS-GADD45a lentivirus plasmid and pSPAX.2 and pMD2.G into 293T cells by using a lipofection transfection method, so as to obtain a recombinant lentivirus; and transfecting an IPEC-J2 cell by using the recombinant lentivirus obtained in the step 2), so as to obtain an IPEC-J2 cell linefor highly expressing the pig GADD45a gene. The novel application of the pig GADD45a gene refers to regulation and control on nutrition absorption and metabolism. The invention exploits novel functions of the pig GADD45a gene and novel methods for research the pig GADD45a gene in epithelial cells of intestinal tracts.

Description

technical field [0001] The invention relates to the new application of porcine GADD45a gene and the construction and application of high-expression cell lines, belonging to the application technology in the field of biology and modern agricultural technology. Background technique [0002] GADD45a (also known as DDIT1) is a member of the growth arrest and DNA damage-induced gene family. It is the first downstream gene of p53 detected and is an important biomarker that can identify genome damage. Participate in the regulation of cell cycle, cell apoptosis, cell senescence and tumor development, etc., and play an important role in the regulation of cell cycle, maintenance of genome stability, cell apoptosis, DNA damage repair and signal transduction and other important cell life activities. [0003] The porcine GADD45a gene mRNA has 1527bp and 4 exons. The full-length coding sequence is 498bp, encoding 165 amino acids and encoding a protein of about 18 kD. However, there are f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/867C12N5/10
CPCC07K14/47C12N5/0625C12N15/86C12N2510/02
Inventor 单体中有文静汪以真
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com