Primers and kit for detecting cat intestinal infection pathogens and application
A technology for detecting reagents and pathogens, applied in the biological field, can solve the problems that the accuracy cannot meet the market demand, the operation is difficult for ordinary veterinarians, and the types of pathogens are not perfect, so as to shorten the detection time, increase the cure rate and make the results easy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0079] Embodiment 1, the preparation of the primer that detects cat enteric infection pathogen
[0080] A kind of primer of this embodiment detects cat enteric infection pathogen, it comprises two primer sets of FPV primer set and FCoV primer set, each set is made of F3 primer, B3 primer, FIP primer, BIP primer, LF primer, LB primer Composed of 6 primers, the sequence of which varies with the pathogens targeted; the FPV primer set includes the outer primer pair FPV-F3 and FPV-B3, the inner primer pair FPV-FIP and FPV-BIP, and the loop primer pair FPV-LF and FPV -LB; the FCoV primer set includes the outer primer pair FCoV-F3 and FCoV-B3, the inner primer pair FCoV-FIP and FCoV-BIP, and the loop primer pair FCoV-LF and FCoV-LB; the detailed sequence is as follows:
[0081] FPV-F3: AATCAAGCAGCAGATGGT
[0082] FPV-B3: tggatctgttggtagcaata
[0083] FPV-FIP: tcaggtgtttctcctgttgtagtaGATCCAAGATATGCATTTGGTAGA
[0084] FPV-BIP: AGATACAGGAAGATATCCAGAAGGAttatcatttgttacaggaaggtt
[008...
Embodiment 2
[0093] Embodiment 2, utilize the test kit that detects feline enteric infection pathogen to detect the sample to be tested
[0094] 1. Preparation of detection kit
[0095] The cat intestinal infection pathogen detection kit described in this embodiment includes two detection reagents of feline distemper virus and feline coronavirus, each reagent is composed of two parts respectively, the first part is a general RM part, and this part has two kinds The composition of the reagents is the same, all consisting of the following raw materials:
[0096] 1 µl Bst enzyme
[0097] 1 µl Hydroxynaphthol Blue (37.5 µM)
[0098] 2 μl MgSO4 (100mM)
[0099] 2.5 μl 10xBst buffer
[0100] 3 µl deionized water
[0101] 3.5 μl dNTP (10mM)
[0102] 4 microliters of betaine (5M); 17 microliters total.
[0103] The second part is the specific PM part, which is the aqueous solution of each primer. The concentration of the aqueous solution is 20 μM, and the volume of the PM part in each reage...
Embodiment 3
[0152] Embodiment 3, accuracy experiment
[0153] Cats with enteric infections can carry both feline distemper virus and feline coronavirus, or either of them. Take a healthy cat as sample 1 to be tested, and then set samples 2-4 to be tested according to the different conditions of the identified pathogens carried by the cat, see Table 1 for details:
[0154] Table 1
[0155]
[0156] Note: "-" means "no", "+" means "yes".
[0157] Each group of samples to be tested is detected by the detection method of Embodiment 2 respectively, and the detection results are observed after the detection is completed, such as figure 2 The detection result of sample 4 to be tested shows that, figure 2 The arrangement order of the middle reagents is: the left 1 is the negative control, and the left 2-3 are the reagents for detecting FPV and FCoV respectively. Depend on figure 2 It can be seen that the negative control of left 1 shows blue-purple, and the detection FPV of left 2-3, t...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com