Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group, kit and detection method based on digital PCR for Y chromosome microdeletion detection

A technology of Y chromosome and detection method, which is applied in the field of biological detection, can solve problems such as lack of related solutions, and achieve the effects of reducing workload, reducing pain, and good product development potential

Pending Publication Date: 2020-01-07
SUZHOU INST OF BIOMEDICAL ENG & TECH CHINESE ACADEMY OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the use of digital PCR for the detection of Y chromosome microdeletions is a research direction, but related solutions are missing in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, kit and detection method based on digital PCR for Y chromosome microdeletion detection
  • Primer group, kit and detection method based on digital PCR for Y chromosome microdeletion detection
  • Primer group, kit and detection method based on digital PCR for Y chromosome microdeletion detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] A primer set for the detection of Y chromosome microdeletions was designed to detect gene deletions at the sY84 and sY86 sites of the AZFa subregion, the sY127 and sY134 sites of the AZFb subregion, and the sY254 and sY255 sites of the AZFc subregion, which specifically included The following primer combinations:

[0045] The primer pair used to detect the SY84 site, the sequence is:

[0046] Upstream primer AGAAGCGTCTGATAGCAGGT, downstream primer GCCTACTACCTGGAGGCTTC;

[0047] The primer pair used to detect the SY86 site, the sequence is:

[0048] Upstream primer GTGACACACAGACTATGCTTC, downstream primer ACACACAGAGTGACAACACT;

[0049] The primer pair used to detect the SY127 site, the sequence is:

[0050] Upstream primer GGCTCACAAACGACGAGAAA, downstream primer CTGCAGGCAGTAATAAGTGA;

[0051] The primer pair used to detect the SY134 site, the sequence is:

[0052] Upstream primer GTCTGCCTCACCATATCACG, downstream primer ACCACTGCCAAAACTGTCAA;

[0053] The primer pair...

Embodiment 2

[0059] A kit for detecting Y chromosome microdeletions was constructed, the kit including the primer set described in Example 1. In a further preferred embodiment, the kit further includes: PCR master mix, positive control, negative control and microdroplet generating oil.

[0060] Wherein, the PCR master mix includes dye, Taq enzyme, dNTP, MgCl 2 . More specifically, the dye is: EvaGreen dye 2x (20x EvaGreen dye diluted 10 times) 0, the Taq enzyme reaction concentration is 6U, the reaction concentration of dNTP is 0.8mM, MgCl 2 The final concentration was 5.6 mM.

[0061] Wherein, the positive control is: blood cell DNA obtained from the peripheral blood of healthy adult males, the concentration is: 10-80ng / ul, and the negative control is sterile deionized water (no DNA and RNA).

[0062] Droplet Generation Oil, QX200 Droplet Generation Oil for EvaGreen, was purchased from Bio-Rad, USA.

Embodiment 3

[0064] A digital PCR-based detection method for detecting Y chromosome microdeletions is provided. The method utilizes the kit obtained in Example 2 to detect Y chromosome microdeletions by means of digital PCR. It specifically includes the following steps:

[0065] 1) Collect peripheral blood or fingertip blood of the patient to be tested, volume range: 50 μl-500 μl, DNA extraction can be performed using a general nucleic acid column extraction kit (Shanghai Sangong, B518253-0050), and the obtained DNA is subjected to ultraviolet ( 260nm) absorption detection to obtain the concentration and purity, and obtain the DNA sample to be tested, the concentration of which is ≥0.0001ng / ul;

[0066] 2) Evenly mix the obtained DNA sample with the PCR master mix, primer set, and sterile water. The volumes are 10ul of the PCR master mix, 0.4ul of the primer set (10uM), 2ul of the DNA extraction solution, and 7.2ul of the sterile water. Vortex and keep at 4°C for use;

[0067] 3) The mix...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group, a kit and a detection method based on digital PCR for Y chromosome microdeletion detection. A primer group is designed for loci of sY84 and sY86 in an AZFa subregion, loci of sY127 and sY134 in an AZFb subregion, and loci of sY254 and sY255 in an AZFc subregion, and the advantages of high sensitivity, accuracy and objectivity are achieved. The detection method can detect the Y chromosome microdeletions of azoospermia patients with rapidness, highly sensitivity and accuracy, and can effectively reduce the requirements for sample sizes so that the peripheral blood collection can further be reduced to fingertip blood, the pain of patients can be reduced, and the false negative results caused by less DNA samples of the patients can be avoided. The digital PCR method is adopted for detection, the detection results can be obtained without dependence on a Ct value, and can directly reflect the original copy number of DNA samples, and thus the workload of a tester is reduced.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a primer set, a kit and a digital PCR-based detection method for detecting Y chromosome microdeletions. Background technique [0002] Infertility is an important reproductive health problem in the world. About 15% of couples will encounter fertility difficulties or infertility, and 30% to 50% of infertility is caused by male infertility or oligospermia. Currently, an important cause of male infertility is abnormal chromosome structure and microdeletion of chromosomal genes. Clinical results show that about 10% to 15% of patients with primary azoospermia and oligospermia have Y chromosome microdeletion, and this symptom can be passed on to the next generation with assisted reproductive technology. Therefore, the detection of Y chromosome microdeletions is of great significance to the clinical treatment of male reproductive genetics, the improvement of the efficacy an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6851C12N15/11
CPCC12Q1/6883C12Q1/6851C12Q2531/113C12Q2563/159
Inventor 殷建尹焕才袁通阔刘荻
Owner SUZHOU INST OF BIOMEDICAL ENG & TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com